ID: 1022675424

View in Genome Browser
Species Human (GRCh38)
Location 7:32495299-32495321
Sequence GCTCCTCGTCAAGTCCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022675416_1022675424 3 Left 1022675416 7:32495273-32495295 CCGGGTCACGTAAGCCCCACCCC 0: 1
1: 1
2: 1
3: 7
4: 135
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72
1022675415_1022675424 4 Left 1022675415 7:32495272-32495294 CCCGGGTCACGTAAGCCCCACCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72
1022675412_1022675424 12 Left 1022675412 7:32495264-32495286 CCCAGCCGCCCGGGTCACGTAAG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72
1022675413_1022675424 11 Left 1022675413 7:32495265-32495287 CCAGCCGCCCGGGTCACGTAAGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72
1022675414_1022675424 7 Left 1022675414 7:32495269-32495291 CCGCCCGGGTCACGTAAGCCCCA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72
1022675409_1022675424 28 Left 1022675409 7:32495248-32495270 CCACAGGCTCTGCAAGCCCAGCC 0: 1
1: 0
2: 5
3: 65
4: 498
Right 1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG 0: 1
1: 0
2: 0
3: 15
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022675424 Original CRISPR GCTCCTCGTCAAGTCCCACC CGG Intergenic
900157050 1:1207299-1207321 GCTCCTCCTCAACTCCCTCCGGG - Intergenic
904859873 1:33528046-33528068 GCTCCTCTGCAACCCCCACCAGG - Intronic
905694288 1:39963359-39963381 CCACCTCATCAAGACCCACCAGG + Intronic
914947331 1:152079099-152079121 GCTCCTCCTCAATTCCCAGATGG + Intergenic
915019498 1:152765661-152765683 GCTCCTCTTCAAATCCCACACGG + Intronic
915840460 1:159208672-159208694 GCTCCTCCTTAAGTCTAACCCGG + Intergenic
920577212 1:207070342-207070364 TGTCCTCGTCATCTCCCACCAGG + Exonic
1067060729 10:43076848-43076870 GCTCCTCCCCAAGCCCCACCCGG + Intergenic
1071980271 10:90998441-90998463 TCTTCTCGTCAAGTCCGGCCTGG + Intergenic
1075925097 10:126245261-126245283 GGTTCACGTCAGGTCCCACCTGG - Intronic
1083198826 11:61107221-61107243 GCTTCTCCTCAGGTCCCACACGG - Intronic
1087301602 11:96442744-96442766 GCTCCTCATCACTTGCCACCTGG - Intronic
1099647370 12:85376139-85376161 GCTCCTCATCCAGTTTCACCAGG + Intergenic
1100202289 12:92312330-92312352 GCTCCTCTTCAAGTCTTCCCTGG - Intergenic
1100242738 12:92726197-92726219 GCTGCTGCTCAAGTCCTACCAGG - Intronic
1102251391 12:111389851-111389873 GCTCCGCCTCAGATCCCACCTGG - Intergenic
1104800716 12:131553837-131553859 GGTCCTCATCAAGGCTCACCAGG - Intergenic
1107553728 13:41499572-41499594 GCTCCGGGTTAAGTCTCACCTGG + Intergenic
1107565692 13:41601828-41601850 CCTGCTCCTCAAATCCCACCTGG + Intronic
1109133997 13:58624937-58624959 GCTCCTCAGCCAGTCCCACCTGG - Intergenic
1110626521 13:77660878-77660900 GCTCCTCCTCAATTCCCAGATGG + Intergenic
1115642138 14:35341665-35341687 GCTCCTCTTCAAGGCCCGGCTGG + Intergenic
1116051375 14:39807545-39807567 GCTCCTAGGCAAGGCCCACACGG - Intergenic
1117306551 14:54482158-54482180 GCTCCTCATCCAGTACCACCAGG + Exonic
1119782979 14:77290522-77290544 ACTCCTCAGCAAATCCCACCTGG - Intronic
1121452747 14:94019877-94019899 GCTGCACCTCAAGTCCCACCTGG + Intergenic
1122303980 14:100749822-100749844 GCTCCTCCTCACCTTCCACCAGG - Intergenic
1122971156 14:105152773-105152795 GCTCCCAGTAAAGTCCCACAAGG + Intronic
1129690466 15:77710368-77710390 CCTGCTGGACAAGTCCCACCAGG - Intronic
1129887392 15:79048173-79048195 GGTCTGAGTCAAGTCCCACCTGG - Intronic
1129904095 15:79173704-79173726 TCTCTTCGTCAAGTCACCCCAGG + Intergenic
1137414337 16:48259664-48259686 GCCCCTTCTCTAGTCCCACCGGG - Intronic
1138435868 16:56999837-56999859 GCTCCTCGCTACCTCCCACCTGG - Intronic
1142194751 16:88734271-88734293 GCTCCTGTCCAACTCCCACCTGG + Intronic
1142519779 17:496857-496879 GCTCTTTGCCAAATCCCACCTGG - Intergenic
1142912872 17:3110950-3110972 GATCATCCCCAAGTCCCACCAGG - Intergenic
1144473253 17:15563126-15563148 GCTCCTCCTCAACTCCACCCCGG + Intronic
1144669536 17:17125210-17125232 GCTCCTCCTCGTGTCCCCCCAGG + Intronic
1144923229 17:18781594-18781616 GCTCCTCCTCAACTCCACCCCGG - Intronic
1145397452 17:22506755-22506777 GCTCCTCATCCAGACTCACCAGG - Intergenic
1148548143 17:48532363-48532385 GCTTCTCTTCTAGTCCCATCTGG - Intergenic
1152248586 17:79199461-79199483 CCTCTTCCTCAAGTCCCACCTGG - Intronic
1152809558 17:82375158-82375180 GCTGCTCGCCCAGTACCACCAGG + Exonic
1156475568 18:37403440-37403462 GCTCCTCCTCCAGTCACACAAGG + Intronic
1157290587 18:46406768-46406790 GCTCCTCATCCTGTCCCACAGGG + Intronic
1160559018 18:79744877-79744899 GCTCTTCCTCAAGACCCTCCAGG - Intronic
1167580365 19:50337649-50337671 CCTCTTCGTCAAGTCCACCCTGG - Intronic
931051517 2:58420242-58420264 TCTCCTGGTCAGTTCCCACCAGG + Intergenic
932063025 2:68527476-68527498 GCTCCTCCTCAATTCCCAGATGG + Intronic
938952563 2:136268684-136268706 GTTTCTCTTCTAGTCCCACCTGG - Intergenic
946339019 2:219056713-219056735 GCTCCCAGCCAAGCCCCACCTGG - Intronic
1171490264 20:25511906-25511928 GCTCCTGATCGAGACCCACCTGG + Intronic
1172160278 20:32863177-32863199 CCTCGTCAGCAAGTCCCACCAGG - Intronic
1173643762 20:44621080-44621102 GCTCATCTTCAAGTCCACCCTGG - Exonic
1182114646 22:27749101-27749123 GCTCCTCGTCAAGACTGCCCAGG + Exonic
1183773674 22:39948350-39948372 GCTGCTTGGCAAGTCCCTCCAGG - Intronic
1185260167 22:49857107-49857129 GCTCCTCATCGAGGCCCACCTGG + Intronic
954698496 3:52439945-52439967 TGTCCTTGTCAAGACCCACCTGG - Exonic
955026314 3:55171168-55171190 GCTCCTCAGCACCTCCCACCTGG + Intergenic
958975625 3:100665335-100665357 GCTCCTCATCCAGTACCACCAGG + Intronic
969967698 4:11014107-11014129 CCTCCTCCTCAGGTACCACCTGG - Intergenic
976827701 4:89279014-89279036 TCTCCTCGTCAAGGCCCAACTGG - Intronic
998206796 5:140163050-140163072 GCTCCTCATCACATCCCAGCTGG + Intergenic
1000125380 5:158238679-158238701 GCTCTTCTTCAAGTCTCACTGGG - Intergenic
1000977820 5:167783867-167783889 GGCCCTGGTCAAGTCCCCCCGGG - Intronic
1002633671 5:180596714-180596736 GCACCTCGGCCAGTCCCAGCAGG + Intergenic
1002766140 6:240503-240525 ACTCCTAGTCAAGTGCCACAGGG - Intergenic
1005243440 6:23855856-23855878 GCTCCTCCTCAATTCCCAGATGG - Intergenic
1007832962 6:44652913-44652935 TCACCTCGACATGTCCCACCAGG - Intergenic
1009398370 6:63228509-63228531 GCTCCTCCTCAATTCCCAGATGG + Intergenic
1019056637 6:169228248-169228270 GCTCCTCTTCAATCCCCGCCAGG - Exonic
1019597315 7:1864141-1864163 GTTCCTCTGCAAGTCCCACCGGG - Intronic
1022675424 7:32495299-32495321 GCTCCTCGTCAAGTCCCACCCGG + Intergenic
1023821962 7:43985529-43985551 CCTCCTCCCCAAATCCCACCAGG + Intergenic
1026892834 7:73992445-73992467 GCTCCTTGTCCAGTCCCGCCTGG + Intergenic
1035529096 8:337120-337142 GCTCCTCGGTAAGCCCCACCGGG - Intergenic
1037514948 8:19620851-19620873 GCTCCTTCTCAAGTCCAACCAGG + Intronic
1043286652 8:78540431-78540453 GCTCCTAGTCAAATCCCTGCAGG + Intronic
1043597545 8:81902574-81902596 GCTCCTCATCAGGTCCAGCCAGG - Intergenic
1046551530 8:115723823-115723845 GCTCCTGGTGAAATCCCACCAGG - Intronic
1052413591 9:28149751-28149773 GCTCCTCCTCAATTCCCAGACGG - Intronic
1053427078 9:38017236-38017258 GCTCCTCAGCCAGTGCCACCCGG + Intronic
1056020079 9:82431591-82431613 GCTCCTCCTCAATTCCCAGATGG + Intergenic
1056071200 9:82988707-82988729 GCTCCCCGTCACCTTCCACCAGG + Intronic
1060590393 9:124812631-124812653 GCTCCTCTTCCAGACTCACCAGG + Exonic
1186700646 X:12086626-12086648 CCTCCACGTCACATCCCACCCGG - Intergenic
1194878416 X:99219386-99219408 GCTCTGAGTCAAGTCACACCTGG + Intergenic
1195643708 X:107205913-107205935 GCACCTGGTCAACTGCCACCCGG - Intronic