ID: 1022675529

View in Genome Browser
Species Human (GRCh38)
Location 7:32495627-32495649
Sequence CGCGGCTTTCCGCACACGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022675519_1022675529 21 Left 1022675519 7:32495583-32495605 CCCTGTGCGGCCCTCATGTGCTG 0: 1
1: 0
2: 2
3: 8
4: 124
Right 1022675529 7:32495627-32495649 CGCGGCTTTCCGCACACGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 12
1022675521_1022675529 11 Left 1022675521 7:32495593-32495615 CCCTCATGTGCTGTGCTCGCTGA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1022675529 7:32495627-32495649 CGCGGCTTTCCGCACACGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 12
1022675522_1022675529 10 Left 1022675522 7:32495594-32495616 CCTCATGTGCTGTGCTCGCTGAC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1022675529 7:32495627-32495649 CGCGGCTTTCCGCACACGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 12
1022675520_1022675529 20 Left 1022675520 7:32495584-32495606 CCTGTGCGGCCCTCATGTGCTGT 0: 1
1: 0
2: 0
3: 13
4: 100
Right 1022675529 7:32495627-32495649 CGCGGCTTTCCGCACACGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 12
1022675518_1022675529 28 Left 1022675518 7:32495576-32495598 CCGATCTCCCTGTGCGGCCCTCA 0: 1
1: 0
2: 1
3: 9
4: 192
Right 1022675529 7:32495627-32495649 CGCGGCTTTCCGCACACGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 12

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022675529 Original CRISPR CGCGGCTTTCCGCACACGGT GGG Exonic