ID: 1022681154

View in Genome Browser
Species Human (GRCh38)
Location 7:32547580-32547602
Sequence GAACCAGGGAGTGGGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 493}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022681154_1022681158 -10 Left 1022681154 7:32547580-32547602 CCTGTCTCCCCACTCCCTGGTTC 0: 1
1: 0
2: 2
3: 64
4: 493
Right 1022681158 7:32547593-32547615 TCCCTGGTTCTGACCCACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022681154 Original CRISPR GAACCAGGGAGTGGGGAGAC AGG (reversed) Intronic
900141710 1:1141539-1141561 GAAGCAGGGATGGGGGGGACAGG - Intergenic
900656610 1:3761921-3761943 CAGCCAGAGAGTGGGGAGAAGGG - Intronic
900985940 1:6072831-6072853 GAAACAGGCTGTGGGGAGGCCGG + Intronic
901559441 1:10058591-10058613 GAGCCAGGCAGTGGGGACTCTGG + Intronic
903278618 1:22237331-22237353 GAACAAGGGAGTCGGGTGCCTGG + Intergenic
903571921 1:24311950-24311972 CAGCCAGGGAGAGGGGAGCCAGG - Intergenic
903812593 1:26043161-26043183 GTATCAGGGAGTGGGTAGAGTGG + Intronic
904430256 1:30459768-30459790 GAGCCAGAGAGTAGGCAGACAGG + Intergenic
904464796 1:30701390-30701412 GATCCAGGCAGTGGGTAGGCGGG - Intergenic
904727200 1:32558327-32558349 GAAGGAGGGAGGGGTGAGACAGG - Intronic
904965965 1:34372828-34372850 GTACCAGGCAGTGGGAATACAGG - Intergenic
905773778 1:40654984-40655006 GGACTAGGGAGGGGGCAGACAGG + Intronic
905834025 1:41101004-41101026 GAACCTGGGGTTGGGGAGGCGGG + Intronic
906060627 1:42946258-42946280 GACCCAGGGAGTGGGTAGGCAGG - Intronic
906108448 1:43308302-43308324 GACCCAGGGATTGGGGACTCAGG + Intronic
906108464 1:43308352-43308374 GACCCAGGGATTGGGGACTCAGG + Intronic
906108480 1:43308402-43308424 GACCCAGGGATTGGGGACTCAGG + Intronic
906108498 1:43308452-43308474 GACCCAGGGATTGGGGACTCAGG + Intronic
906711560 1:47934231-47934253 GAACCAGAGACTGGGGAGTCAGG - Intronic
906770436 1:48478688-48478710 GAAGCAGGGAGAAGGGAGAAGGG - Intergenic
906772278 1:48495772-48495794 CACCCAAGGAGTGGGGAAACTGG + Intergenic
906809420 1:48811020-48811042 GAACCAGGGATGGGGGAAAAAGG - Intronic
907269485 1:53282466-53282488 GAAACTGGGAGTTGGGAGATGGG + Intronic
907400506 1:54222229-54222251 GAACCAGGCTGTGGGGACCCAGG + Intronic
907672885 1:56492388-56492410 CACCCAGGGAGTGGAGGGACTGG - Intergenic
908509078 1:64836802-64836824 GAGCCAGGGAGTCTGGAGCCAGG - Intronic
908509082 1:64836817-64836839 GAGCCAGGGAGTCTGGAGCCAGG - Intronic
908896215 1:68903187-68903209 GAAGTAGGGAGTGTGGAGAAAGG + Intergenic
909109543 1:71457214-71457236 CAGCCAGGTAGTGGGGAGAACGG - Intronic
909602582 1:77476356-77476378 TCACCAGGGAGAAGGGAGACTGG - Intronic
910338140 1:86156277-86156299 GAACCAGGGGGTGGAGAGAGGGG + Intronic
911886153 1:103302125-103302147 GAACCAAAGAGTGGTGAGAGTGG - Intergenic
911937213 1:103992645-103992667 GAATCAGGAAGTGGGGAGAATGG + Intergenic
912194072 1:107377315-107377337 GAGCCAGGCAGTGGGGAGCTTGG - Intronic
912369055 1:109158974-109158996 GAACCTGGGAGTGGGGGCAGAGG - Intronic
912449655 1:109761152-109761174 GCAGCAGGGGGTTGGGAGACAGG + Intronic
913161146 1:116147121-116147143 GAAGCAGGGAGTGGTGTCACAGG - Intergenic
914755181 1:150558299-150558321 GAACCAGGGACTGGGGGCCCAGG + Intronic
915225968 1:154411638-154411660 GAAGCAGTTAATGGGGAGACAGG - Intronic
915228530 1:154428960-154428982 AATCCAGGGAGTGGGGTGGCTGG + Intronic
915419661 1:155769847-155769869 GAGTAAGGGAGTGAGGAGACAGG + Intronic
916008175 1:160680732-160680754 GAAAGAGGGACTGAGGAGACGGG - Intronic
923251324 1:232181779-232181801 CAGCCAGGGAGTGGGAAGACTGG + Intergenic
923259809 1:232258003-232258025 CAACAAGGGAATGGGGAGAAGGG - Intergenic
924898211 1:248365560-248365582 GGCCCCGAGAGTGGGGAGACAGG - Intergenic
1064164105 10:12972196-12972218 GAACCAGTGAGGGTGGAGAGTGG - Intronic
1065001893 10:21345000-21345022 GTGACAGGGAGTGGGGAGAAAGG - Intergenic
1065370462 10:24979882-24979904 CAGCCAGGCAGTGGGGAGGCGGG - Intergenic
1065754890 10:28922192-28922214 GACACAGGGAGTGGGGAAAGGGG - Intergenic
1067016313 10:42758364-42758386 AAAGCAGGGACTGGGGAGAAGGG + Intergenic
1067281743 10:44878708-44878730 GAACCTGGGAGGGGGCAGCCTGG + Intergenic
1067440887 10:46308715-46308737 GAGCCTGGAAGTGGGGAGAGAGG + Intronic
1067577023 10:47415405-47415427 GAGCCTGGAAGTGGGGAGAGAGG + Intergenic
1067712254 10:48658672-48658694 GGACCAGGGTGAGGGGAGAGGGG - Intergenic
1067991932 10:51224061-51224083 GAACCATGGAGTGGGAAAATAGG + Intronic
1068662498 10:59637117-59637139 GAGACAGGGAGCGGAGAGACTGG - Intergenic
1069842277 10:71347313-71347335 GAGTCAGGGAGTCGGGGGACCGG + Intronic
1069874420 10:71552974-71552996 GAAGCTGGGAGTGGGGGGACTGG - Intronic
1069897472 10:71688533-71688555 GAACCAGGGATGGTGGAGTCAGG + Intronic
1069916377 10:71789570-71789592 GGAACAGGGGCTGGGGAGACTGG - Intronic
1069917063 10:71793685-71793707 GAAGCAGGGAGCGAGGAGACAGG - Intronic
1069998028 10:72354915-72354937 GAACCAGGGAGGGGGAGGCCGGG + Exonic
1070214005 10:74356763-74356785 GAACCAGAGTGTTGGGAGACAGG + Intronic
1070537056 10:77387027-77387049 GAACCCGGGAGTGGGCTGAGGGG + Intronic
1070742917 10:78914141-78914163 GTAGCAGGGAGTGAGCAGACTGG + Intergenic
1071162925 10:82772468-82772490 GCACAAGGGAGTGGGGAAAGGGG - Intronic
1073268201 10:102241050-102241072 GAGGCAGGGAGTAGGGAGTCTGG - Intronic
1074411224 10:113230359-113230381 GAAACGGGGAGTGGGAAGGCTGG + Intergenic
1075920413 10:126207227-126207249 AAACAATGGAATGGGGAGACAGG + Intronic
1076071686 10:127495512-127495534 GAACTAGGGAGTGGGAATGCGGG - Intergenic
1076300587 10:129423026-129423048 GAACCAGTAACTGGGGACACGGG - Intergenic
1076527126 10:131118920-131118942 GCACCTGGGAGTGGAGAGCCGGG + Intronic
1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG + Intronic
1076866691 10:133169884-133169906 GAACCACGGAGTAGGGGGACCGG - Intronic
1076878972 10:133230832-133230854 GAACCAGGTAGGCGGGGGACTGG + Exonic
1077162179 11:1118905-1118927 GAAGGAGGGAGTGGGGAGGCTGG + Intergenic
1078060397 11:8039368-8039390 GCACTGGGGGGTGGGGAGACAGG - Intronic
1078424812 11:11240531-11240553 GAAGAAGTGAGTGGGGAGAGGGG - Intergenic
1078612290 11:12831138-12831160 GAACCATGGAGTGGTGAAATGGG - Intronic
1079110262 11:17601469-17601491 GAGCCAGGGCGTGGGGGGAGTGG + Intronic
1079322296 11:19461254-19461276 GGACCAGGGAGAGGGGAGGCGGG - Intronic
1081803378 11:45875155-45875177 TAACCAGGAAGTGTGGATACTGG + Intronic
1081881331 11:46455334-46455356 TGACCAGGGACTGGGGAGAGAGG - Intronic
1082013761 11:47469201-47469223 TGACCAGGGAGTGGGGAGAGAGG - Intronic
1082801214 11:57416294-57416316 GAACCGAGGAGTGGGGGGAAGGG + Intronic
1083308193 11:61771663-61771685 GAACCAGGGCCCGGGGAGAGCGG - Exonic
1083314017 11:61803015-61803037 GCACCAGTGAGTAGGGAGCCTGG - Exonic
1083844860 11:65325518-65325540 GGACTAGGGGGTGGGGAGAATGG - Intergenic
1084063508 11:66690403-66690425 GAGCCAGGGAGTGGGGGTGCTGG + Intronic
1084068334 11:66718373-66718395 GGACCTGGGTGTGGGGAGAGTGG - Intronic
1084160503 11:67346691-67346713 GAAACTGGGAGGGGGAAGACAGG - Intronic
1084174356 11:67415793-67415815 GAGCCAGGGAGGGGGGCGGCCGG + Intronic
1085647936 11:78240052-78240074 GCCCAAGGGAGTGGGGAGAGGGG - Intronic
1089706117 11:120279162-120279184 GAACCACAGAGTCGGGAGTCTGG - Intronic
1090164879 11:124536280-124536302 GGACGAGGCAGTGGGGAGACTGG - Intergenic
1090213752 11:124942190-124942212 GGCCCAAGGAGTGGGGAGAGAGG - Intergenic
1090967246 11:131609771-131609793 GAACTAGGGACTGGGTAGAAGGG - Intronic
1091010677 11:131997967-131997989 GAACCAGGGAGTGAGGGGAGGGG - Intronic
1091015903 11:132050524-132050546 TTACCATGAAGTGGGGAGACAGG + Intronic
1091266040 11:134271798-134271820 GAACAGGGCAGTGGCGAGACAGG + Intergenic
1091922451 12:4316308-4316330 GAACCCGGGAGGCGGGAGGCGGG + Intergenic
1091951742 12:4598593-4598615 GAACAAGAGAGTGGGCAGATGGG - Intronic
1093769485 12:23002492-23002514 GAACCAGGGGCTGGGGATAGTGG + Intergenic
1095999577 12:48117900-48117922 GAAGCAGGGAGGGGGGAGCGGGG + Intronic
1096262853 12:50103873-50103895 GAGCCAGGGAAAGGAGAGACAGG - Exonic
1096597274 12:52703971-52703993 GAAGCAGTGTGTGGGGAGATTGG - Intergenic
1096689236 12:53309237-53309259 GAACCAGGGAAGGGGGACACAGG + Exonic
1096870101 12:54587820-54587842 GCTCCAGGGAGAGGGGAGAGGGG - Intronic
1100581235 12:95942665-95942687 GAACCTGGGGGTGGGGAGGAGGG - Exonic
1100675608 12:96863546-96863568 GAGCCATGGAGTGGGTAGAAGGG - Intronic
1101512211 12:105403526-105403548 GCCCCAGGCAGTGGGGAGAAAGG - Intergenic
1102375011 12:112415231-112415253 GAAGCGAGTAGTGGGGAGACGGG + Intronic
1102464463 12:113120374-113120396 GAACCAGGGAGGCAGGTGACAGG - Intronic
1102809138 12:115808983-115809005 GAACCAGGGAGAGGGGAGGGTGG - Intergenic
1103177225 12:118875048-118875070 GAGCCAGGGGGTGGGAAGAATGG + Intergenic
1103339462 12:120213786-120213808 GGAGCAGGCAGTGGGGAGAGAGG - Intronic
1103561981 12:121797598-121797620 GATCCAGGGAGGGGAGAAACTGG + Intronic
1104190399 12:126476813-126476835 GGGTCAGGGAGTGGGGAGAGGGG + Intergenic
1104457199 12:128924785-128924807 GAACGGGGCAGTGGGGAGAGTGG + Intronic
1104684793 12:130777831-130777853 GGATCAGGGAGTGGGGATGCTGG - Intergenic
1104689455 12:130814397-130814419 TGACCTGGGAGTGGAGAGACTGG + Intronic
1105210291 13:18253352-18253374 GGCCCAGAGAGTGGGGAGACAGG + Intergenic
1105459010 13:20566854-20566876 GAACCGGGGGGTTGGGAGGCTGG - Intergenic
1105514490 13:21077423-21077445 GAACCAAGGTGTGGGTAGGCTGG + Intergenic
1105697908 13:22908670-22908692 GAACCAGGTAATGGGGAGAGAGG - Intergenic
1105701956 13:22940600-22940622 GAACCAGGGTGTGGGCAGCGGGG - Intergenic
1105794928 13:23842510-23842532 GAACCAGGGAGCGAGGGCACTGG - Intronic
1106230190 13:27815498-27815520 GGGCATGGGAGTGGGGAGACAGG - Intergenic
1106483571 13:30154624-30154646 GATGCAGGGAATGGGCAGACAGG - Intergenic
1108676118 13:52739256-52739278 CCCCCAGGGAGTGGGGAGTCGGG + Intronic
1110344934 13:74435019-74435041 GAAGCAGGAACTGGGGAGAAAGG - Intergenic
1111639078 13:90945327-90945349 TAAGCAGAGAGTGGGGAGAGTGG + Intergenic
1111856167 13:93640677-93640699 GAAACAGGGAGCGGGGAGGGAGG - Intronic
1112028819 13:95438646-95438668 AAATAAGGGAGTGGGGAGAGAGG - Intronic
1112210885 13:97375880-97375902 GAGCCAGCGAGTGGGGTGAGTGG + Intronic
1112249188 13:97763432-97763454 TTGCCAGGGAGTGGGGAGATAGG + Intergenic
1112385274 13:98933780-98933802 GATTCAGGGAGAGGGGAGACAGG - Intronic
1112586558 13:100723625-100723647 GAGGCTGGGGGTGGGGAGACTGG + Intergenic
1113519379 13:110928584-110928606 TAGCCAGGGTGTGGGGAAACAGG - Intergenic
1113810759 13:113141114-113141136 GTGCCAGGGGGTGGGGACACAGG + Intronic
1115321453 14:32083801-32083823 GAACCAAGAAGTGGGGAGAAGGG - Intronic
1115453695 14:33577555-33577577 GAACCAGGAAGTGGTAAGCCAGG + Intronic
1115739822 14:36376366-36376388 AAACCAGGGAGTAGGGAGGATGG + Intergenic
1117374007 14:55104327-55104349 GAAGCAGGAAGTAGGGTGACTGG + Intergenic
1118512401 14:66489840-66489862 GAGCCAGGGAGTAGGGGGAAGGG + Intergenic
1118849390 14:69572734-69572756 GAACCAGGGTCAGGGCAGACGGG + Exonic
1118889091 14:69892646-69892668 GAGCAAGGGAATAGGGAGACTGG - Intronic
1118994260 14:70822409-70822431 GAGACAGAGCGTGGGGAGACGGG - Intergenic
1119390862 14:74290171-74290193 GAACAAGGAAGAGAGGAGACAGG - Intronic
1119750777 14:77075889-77075911 CAACCAGCAAGTGGGGAGAGGGG + Intergenic
1119859111 14:77923897-77923919 GGAGCAGGGAGAGGGGAGGCGGG + Intronic
1119902889 14:78276314-78276336 GAACCAGAGGGAGGGGAGATCGG + Intronic
1120188161 14:81415975-81415997 GAAGCAGGGTGTGGGGAGCCCGG + Intronic
1120266350 14:82255781-82255803 GGACTAGGGAGTGGGTAGAGAGG + Intergenic
1121041436 14:90752194-90752216 GAAGCAAGGAGTGGAGAGTCCGG - Intronic
1122510705 14:102264924-102264946 GAACCAGGGAGTCAGGCTACAGG - Intronic
1122760096 14:104017460-104017482 GATTCAGGGAGTGAGGAGACAGG + Intronic
1124210885 15:27764151-27764173 GAAAGAGGGAGGAGGGAGACGGG + Intronic
1124611787 15:31214526-31214548 GAAGGAGGGAATGGGGAGAAGGG - Intergenic
1125525997 15:40375041-40375063 GAACAAGGGTGTGGGTAGAAAGG - Intergenic
1125589707 15:40846631-40846653 GAACCGGGGATTGGGGAGTTTGG + Intronic
1125875143 15:43137698-43137720 GAATCATGGAGTGTGTAGACAGG + Intronic
1128522846 15:68386901-68386923 GAAGCAGGGAGAGGTGGGACAGG + Intronic
1128544099 15:68555806-68555828 GAGCCAGGGAGGAGGGGGACAGG + Intergenic
1128659872 15:69490990-69491012 GAATAAGGGAGTGGGGAGTGGGG + Intergenic
1128988741 15:72241102-72241124 GGGGCAGGGGGTGGGGAGACTGG - Intergenic
1129336293 15:74854076-74854098 GACCCAGGGAGTTGGGTGACAGG + Exonic
1129686773 15:77690684-77690706 GAGCCAGGGAATGGGTAGAGGGG + Intronic
1132122429 15:99188818-99188840 GAAACAGGTTGTGGGGAAACTGG + Intronic
1132834907 16:1947876-1947898 GCACCTGGGAGTGGGGAGCTCGG + Intronic
1132904939 16:2277755-2277777 GTCCCAGGGATTGGGGAGATGGG + Intronic
1133024056 16:2980115-2980137 GAACCAGGAATTGGGGAGGACGG + Intronic
1133111460 16:3550415-3550437 GAACCAGGGCCTGGAGAGCCTGG - Exonic
1133203896 16:4221396-4221418 GAACTAGGGAGTAGGCAGCCTGG - Intronic
1133330501 16:4970304-4970326 GAAGCAGGGAGTGGGGAGGTGGG + Intronic
1133380144 16:5323002-5323024 CAGCTAGGGAGTGGGGAGTCAGG - Intergenic
1134742683 16:16561802-16561824 GATCCAGAGGGTGGGGGGACTGG - Intergenic
1134856032 16:17520083-17520105 GAAAGAGAGAGTGGGGAGAGAGG + Intergenic
1134924876 16:18150662-18150684 GATCCAGAGGGTGGGGGGACTGG + Intergenic
1135022731 16:18976487-18976509 GATCCCTGGAGAGGGGAGACAGG + Intergenic
1135988430 16:27201933-27201955 GAACCTGGAAGTGGGGTGAAAGG + Intergenic
1136687276 16:32002852-32002874 GGGCCTGGGAGTGGGGAGGCAGG + Intergenic
1136716826 16:32288527-32288549 GCTCCAGGCAGTGGGTAGACTGG - Intergenic
1136787891 16:32946403-32946425 GGGCCTGGGAGTGGGGAGGCAGG + Intergenic
1136835202 16:33494772-33494794 GCTCCAGGCAGTGGGTAGACTGG - Intergenic
1136881893 16:33907386-33907408 GGGCCTGGGAGTGGGGAGGCAGG - Intergenic
1137492270 16:48943194-48943216 CAACCAGGGGGTGGGGAGTGCGG + Intergenic
1137530079 16:49273875-49273897 GATATAGGGGGTGGGGAGACGGG + Intergenic
1137785431 16:51134322-51134344 GAGGCAGGCAGTGGGGAGAGGGG - Intergenic
1137854664 16:51782176-51782198 CAAGTAGGAAGTGGGGAGACAGG - Intergenic
1137886283 16:52107304-52107326 GACCCAGGGAGTGGGGGAATAGG - Intergenic
1138126876 16:54446538-54446560 GGAGCAGGGGGTGGGGAGAGGGG - Intergenic
1138326753 16:56178644-56178666 GAGCCAGGGAGAGGGGGGAATGG - Intergenic
1138442214 16:57041963-57041985 GAAGCTGGGGGTGGGGAGAAGGG - Exonic
1138522247 16:57577712-57577734 GCCCCAGGGAGTGGGGACACAGG + Intronic
1138537599 16:57668132-57668154 GACCCAGGGTGCGGTGAGACTGG + Intergenic
1138538117 16:57670530-57670552 GAAACAGGGAGAGGGAAGAGAGG - Intronic
1140445691 16:75025864-75025886 ACACCAGGCAGTGGGGGGACGGG + Intronic
1140972123 16:80023542-80023564 GATACAGTGAGTGGTGAGACAGG + Intergenic
1141657236 16:85422743-85422765 GAGCCAGGGAGTGAGGAGAGAGG + Intergenic
1141659950 16:85436441-85436463 CAACCAGGGAGAGGGCAGATTGG - Intergenic
1142160660 16:88555773-88555795 GAGCCAGGGGGTGGGCAGAGGGG - Intergenic
1142240259 16:88941575-88941597 GGAGCAGGGAGAGGGGAGAGGGG + Intronic
1142399360 16:89851280-89851302 GAACCAGGGCCTGGAGAGGCTGG - Intronic
1203009601 16_KI270728v1_random:229260-229282 GCTCCAGGCAGTGGGTAGACTGG + Intergenic
1203090118 16_KI270728v1_random:1208060-1208082 GGGCCTGGGAGTGGGGAGGCAGG + Intergenic
1203145375 16_KI270728v1_random:1795093-1795115 GCTCCAGGCAGTGGGTAGACTGG - Intergenic
1142507979 17:377562-377584 GAAAGAGAGAGTGGGGAGAGGGG + Intronic
1142804365 17:2363720-2363742 GAAACAGGGAGTTGGGAGGCTGG - Intronic
1142960863 17:3551777-3551799 GCACCAGGGAGTCTGGAGATAGG - Intronic
1143201481 17:5116319-5116341 GAAGCCGGGAGTGGTGAGGCGGG - Intronic
1143466011 17:7137240-7137262 AAATTAGGAAGTGGGGAGACGGG + Intergenic
1143483525 17:7239939-7239961 GAATCAGGGAGGGAGAAGACTGG - Intergenic
1143501841 17:7343799-7343821 GCACAAGGGAATGGGGAGAGGGG + Intronic
1146051873 17:29560621-29560643 GAAACAAGAAGTGGGGAGAAGGG + Exonic
1146400504 17:32497029-32497051 GAAGCAGGGAGGGTGGAGGCAGG - Intronic
1146525468 17:33563687-33563709 GAACCAGTGAGGGGCCAGACTGG + Intronic
1146688290 17:34856523-34856545 GATCCAGGGGGTGGGGAAAATGG + Intergenic
1147056337 17:37838227-37838249 GAACCTGGGAGTGGGGCTGCTGG + Intergenic
1147143081 17:38469936-38469958 GAGCGAGGGTGTGGGGAGAGAGG + Intronic
1147148255 17:38498521-38498543 GGGCCTGGGAGTGGGGAGGCGGG + Intronic
1147168960 17:38607085-38607107 AGACCAGGAAGTGGGGAAACCGG - Intergenic
1147317032 17:39626005-39626027 GAAGCAGGGTTGGGGGAGACAGG - Intergenic
1149145649 17:53489881-53489903 GAACCAGGAAGTGGGTAATCGGG + Intergenic
1149492405 17:57094573-57094595 GTACCAGGGAGTGGTGAAAATGG + Intronic
1149563756 17:57627666-57627688 GACACAGGGAGCGGGGAGGCGGG - Intronic
1149867904 17:60160926-60160948 GAAGCAGGGGGAGGGGAGGCAGG + Intronic
1149954895 17:61037691-61037713 GAACCAGGGAGGCGGCAGCCTGG + Intronic
1150649625 17:67001365-67001387 GAACCAGGGGGAGGGGACAGGGG - Intronic
1151453631 17:74213843-74213865 GAAAAGGGGAGAGGGGAGACGGG - Intronic
1151784891 17:76270569-76270591 GGGCCAGGGAGGGGGGAGCCGGG + Exonic
1151880807 17:76893372-76893394 GAGTCAGGGAGAGGGGAGGCTGG - Intronic
1152089752 17:78239989-78240011 GAACAAGGGAGGGGGCAGAGGGG - Exonic
1152103418 17:78315672-78315694 AACCCAGGCAGTGGGGAGGCTGG - Intergenic
1152270971 17:79324684-79324706 GACCCTTGGAGTGGGGAGCCTGG + Intronic
1152378524 17:79930537-79930559 GAAGGAGGGGGTGGGGAGGCGGG + Intergenic
1152637490 17:81436111-81436133 GGAGGAGGGAGTGGGGAGATGGG - Intronic
1152736508 17:81999946-81999968 GGACAAGGGAGTGGGGAGTGAGG + Intronic
1152922173 17:83071548-83071570 GAGGCAGGGAGTGGGGAGGCCGG + Intergenic
1153769081 18:8401037-8401059 GAATCTGGGGGTGGGGAGAGGGG - Intronic
1154338626 18:13485315-13485337 GAAACACGGAGTTGGGAGCCAGG + Intronic
1155461052 18:26084018-26084040 GAACCAGGGCTTGGAGAAACGGG + Intronic
1155817044 18:30325603-30325625 GAACCAATGACTGGGGAGGCAGG - Intergenic
1156593592 18:38519999-38520021 TAACCAGAGAGGGGAGAGACAGG + Intergenic
1157124022 18:44938060-44938082 GAAGCAGGGAGTGGGGGAGCAGG + Intronic
1157279368 18:46335578-46335600 GTATGAGGGAGTGGGGAGAGGGG - Intronic
1157449218 18:47772849-47772871 GAGCCACGGAGTGGAGACACAGG - Intergenic
1157484215 18:48075580-48075602 CATCCTGGGAGTGGGGAGGCAGG - Intronic
1160462064 18:79046784-79046806 GACCCAGGGAGGGGCCAGACGGG + Intergenic
1160616351 18:80132697-80132719 GAAAGAGGGAGAGGGGAGAGGGG - Intronic
1160691610 19:462894-462916 GACCCAGGGCGAGGGGAGGCCGG - Intergenic
1160841921 19:1150164-1150186 GAACCATGGGGTGGGGACATCGG - Intronic
1161092806 19:2371055-2371077 GGGCCAGGGAGTAGGGTGACAGG - Intergenic
1161571752 19:5034662-5034684 AAACCAGGGAGTGGAGGGAGGGG - Intronic
1161935348 19:7368553-7368575 GAGCTGGGGAGTGGGGAGCCAGG - Intronic
1162403929 19:10462231-10462253 GAACCCGGGAGGCGGGAGGCGGG - Intronic
1162420373 19:10562694-10562716 GAACCAGGGGGTGGGGATGTAGG + Intronic
1162535588 19:11261706-11261728 GAACCAGCTGGTGGGCAGACGGG - Intronic
1162758814 19:12876109-12876131 GAACCAGGGAGAGGAGCAACGGG - Exonic
1162938524 19:13994148-13994170 GTACCAGGGACTGGGAAGGCAGG - Intronic
1162965810 19:14155524-14155546 GGATCTGGGAGTGGGGCGACAGG + Exonic
1163721379 19:18899757-18899779 GGGGCAGGGTGTGGGGAGACAGG + Intronic
1164516617 19:28942265-28942287 GAACCAGGTATTGTGGAGAAAGG + Intergenic
1164907336 19:31978071-31978093 TAAACAGGGAGAGAGGAGACAGG + Intergenic
1165112754 19:33511848-33511870 GAACAATGGAGTGGAGAGACGGG + Intronic
1165694212 19:37888327-37888349 GAATCAGGAAGAGGGGAAACTGG - Exonic
1165840931 19:38788945-38788967 GTGCCAGGCAGTGGGAAGACAGG + Intergenic
1165882934 19:39056337-39056359 GAACAAGGAAGTGGGGAGCCTGG - Intergenic
1166370393 19:42297137-42297159 GAAGCAGGGAGTGCAGAGCCCGG + Exonic
1166855905 19:45782526-45782548 GGACCAAGGGGTGGGGAGAAGGG - Intronic
1167249978 19:48394495-48394517 GAGCCAGGGAGAGGCGGGACTGG + Intergenic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1167348894 19:48963046-48963068 GACCCAGAGAGAGGGGGGACAGG - Intergenic
1167596836 19:50432462-50432484 GAAGCAGGGAGGGGAGGGACAGG - Intergenic
1168355377 19:55696755-55696777 CCACCAGGGAGTGGGCACACAGG - Intronic
925043233 2:750463-750485 GAACCTGGGATGGTGGAGACTGG - Intergenic
928197678 2:29227111-29227133 GAGGCTGGGAGTGGGGAGGCAGG - Intronic
928249301 2:29660660-29660682 GGCCCAGGGAGAGGGGAGAAAGG + Intronic
928331843 2:30363885-30363907 GAACCAGGTAGCTGGGAGAGGGG - Intergenic
930146665 2:48014056-48014078 GAACTAGGGAGTTGGGGGATGGG + Intergenic
930219670 2:48733633-48733655 GGGCCAGGGAATGGGGAGAGAGG + Intronic
930237234 2:48900078-48900100 GAAAGAGGGAGTGAGGAGAGAGG + Intergenic
930777703 2:55190767-55190789 GAATCGGTGAGTGGGGAGAAGGG + Intronic
931945433 2:67301067-67301089 GAGCCTGGGAGCTGGGAGACAGG - Intergenic
932180948 2:69645054-69645076 GCACTAGGGAGTGGGGAAAGCGG - Intronic
932283443 2:70513870-70513892 TAACCAGGGAGTTGTGGGACTGG + Intronic
932811977 2:74833789-74833811 GACCCGGGGTGTGGGGCGACTGG - Intergenic
934035983 2:88088791-88088813 GAGCCAGAGAGAGGGGAGTCAGG + Intronic
934125557 2:88885865-88885887 CAGCCAGGGAGTCTGGAGACTGG - Intergenic
934717865 2:96553675-96553697 GCACCAGGGAGTGGGTGGCCAGG + Intergenic
936637722 2:114278191-114278213 GAAGTAAGGAGTGGGGAGTCGGG - Intergenic
936963169 2:118098451-118098473 GAGCCAGTGAGTGGTGTGACTGG + Intronic
937059796 2:118972429-118972451 GAAGCAGGGACTTGGGAGACTGG + Intronic
937388141 2:121455915-121455937 GAAGCTGGGGGTTGGGAGACTGG + Intronic
938124661 2:128663298-128663320 AAATCAGGGAGAGGAGAGACCGG + Intergenic
938480639 2:131658817-131658839 GATCCAGGGTGTGGAGAGGCGGG + Intergenic
938671554 2:133591121-133591143 GAACCAGTGAGTGCGGGGAGAGG + Intergenic
938707572 2:133945640-133945662 GACCCAGACAGTGGGGAGAGAGG - Intergenic
939629178 2:144513979-144514001 GAAAGAGGGAGTGGGGTGAGGGG - Intronic
939998273 2:148940636-148940658 AAACAAGGGAGTGGGCAGAAAGG - Intronic
941644109 2:168021882-168021904 CAACCAGGTAGTTGGGTGACAGG - Intronic
941695942 2:168550901-168550923 TCACTAGGAAGTGGGGAGACAGG + Intronic
942244955 2:173999319-173999341 GAACCAGGGAGAAGGGTGCCTGG - Intergenic
943830074 2:192449697-192449719 GGAAGATGGAGTGGGGAGACAGG - Intergenic
943844848 2:192633175-192633197 AAGCCGGGGGGTGGGGAGACTGG - Intergenic
943888147 2:193249396-193249418 GTAGCAGGCAGTGGTGAGACAGG + Intergenic
944490352 2:200252665-200252687 GAACTAGAGAGTGGTGAGAAAGG - Intergenic
946143026 2:217707413-217707435 GAGCCAGGGAAAGTGGAGACAGG + Intronic
946421621 2:219568215-219568237 GAACCAGGCCGTGGGGATGCGGG + Exonic
946821629 2:223635697-223635719 GGACTAGGGAGAGGGGAGAATGG + Intergenic
947106611 2:226674445-226674467 CAACAAGGGACTGGGGAGAGAGG + Intergenic
947700957 2:232233498-232233520 TTGGCAGGGAGTGGGGAGACTGG + Intronic
947805815 2:232967170-232967192 GAGCAAGGGAGTGGGGTGAGAGG - Intronic
947899881 2:233712457-233712479 TAAACAGGGAGTGGGGAGGCTGG - Intronic
1169146926 20:3258828-3258850 GAGCCTGGGAGTAGGGAGAGAGG - Intronic
1170250896 20:14281399-14281421 GTGCCAGGGAGTGGGGATAGTGG + Intronic
1170821465 20:19758527-19758549 GGATCAGGGAGTGGGGACAAGGG + Intergenic
1171291435 20:23985042-23985064 GGCCCAGAGAGTGGGGAGACAGG + Exonic
1171316912 20:24203283-24203305 GAAACAGAGAGTGTGGAGCCAGG - Intergenic
1172468187 20:35172506-35172528 GCCCCAGGGAGAGGGGAGAAAGG + Intronic
1172774910 20:37401693-37401715 GACCAAGGGTGTGGGGAGGCGGG - Intronic
1172785164 20:37463967-37463989 CAACAAGTGAGTGGGGACACAGG - Intergenic
1173580406 20:44142950-44142972 GCACCTGGGACTGGGGAGCCGGG + Intronic
1173923214 20:46761512-46761534 CAACCAGGAAGTGAGGAGATTGG + Intergenic
1173998969 20:47360573-47360595 GAATCAGGCTGTGGGGAGCCAGG + Intergenic
1174264252 20:49319766-49319788 GAAGAAGGGAGTGGGGTGGCGGG - Intergenic
1174672621 20:52322190-52322212 GTGCCAGGGACTGGGGAGGCAGG + Intergenic
1176038395 20:63051448-63051470 GAACCAAGGAGGTGGGAGGCTGG - Intergenic
1176150221 20:63586970-63586992 GAACCTGGGAGAGGGGAGGAAGG + Intergenic
1177198702 21:17930109-17930131 CAAGGAGGGAGTGGGAAGACAGG + Intronic
1177674376 21:24277316-24277338 GAGGGAGGGAGTGGGGAGAGAGG - Intergenic
1178359869 21:31939846-31939868 GAACCAGGGTGTGGGGAGAGAGG - Intronic
1178606740 21:34043769-34043791 GGACCTGGGCGTGGGGAGACAGG + Intergenic
1178622271 21:34187090-34187112 CAACCCGGGAGCGGAGAGACTGG + Intergenic
1179296777 21:40070004-40070026 GAGCCAGGGAGTGGGTAGTCAGG - Intronic
1179448477 21:41451044-41451066 GAAGAAGGGAGCGGGGAGAGGGG + Intronic
1179509826 21:41865134-41865156 GAGCCGGGGAGTGGGGAGTGGGG - Intronic
1180765964 22:18346051-18346073 GGCCCAGAGAGTGGGGAGACAGG - Intergenic
1180780349 22:18516327-18516349 GGCCCAGAGAGTGGGGAGACAGG + Exonic
1180813065 22:18773648-18773670 GGCCCAGAGAGTGGGGAGACAGG + Intergenic
1181199242 22:21207964-21207986 GGCCCAGAGAGTGGGGAGACAGG + Exonic
1181345188 22:22214895-22214917 GAGCCAGGGAGTGGAGAAGCTGG - Intergenic
1181400523 22:22647893-22647915 GGCCCAGAGAGTGGGGAGACAGG - Intronic
1181702503 22:24628991-24629013 GGCCCAGAGAGTGGGGAGACAGG - Exonic
1181885182 22:26016542-26016564 TGACCAGTGAGTGGGGATACTGG + Intronic
1183666110 22:39246776-39246798 GCTCCAGGCACTGGGGAGACAGG + Intergenic
1183751872 22:39725505-39725527 GAGACAGGTGGTGGGGAGACAGG - Intergenic
1184095691 22:42315109-42315131 CAAGCAGGGAGGGGGCAGACAGG + Intronic
1184534630 22:45078015-45078037 GAAGCTGGGAGTGTGGAGCCGGG + Intergenic
1203227583 22_KI270731v1_random:86942-86964 GGCCCAGAGAGTGGGGAGACAGG - Intergenic
949499904 3:4669768-4669790 GACCAAGTGAGTGGGGAGCCAGG + Exonic
949980482 3:9499449-9499471 GCACCAGGGAGTTTGGAGTCAGG - Exonic
950444651 3:13029606-13029628 GACCCAGGGAGTCAGGATACAGG - Intronic
950779345 3:15377951-15377973 GAAGTAGGGAATTGGGAGACAGG + Intergenic
951605521 3:24429884-24429906 GATGCAGGGTTTGGGGAGACAGG + Intronic
951866572 3:27315294-27315316 AAGCCAGTGAGTGGGCAGACTGG + Intronic
952719005 3:36513037-36513059 GAACAAGGGAGTGAGGGTACAGG + Intronic
953423354 3:42772360-42772382 GAGCCAGGGAGTAGGAAGAGTGG + Intronic
953906843 3:46872627-46872649 GACCATGGGAGTGGGGAGACTGG - Intronic
954104106 3:48399842-48399864 GCCCCAGGGAGTGGAGTGACAGG - Intronic
954249818 3:49358759-49358781 GAGACAGGGAGGAGGGAGACCGG - Intergenic
954373155 3:50180240-50180262 GAACCGGGGAGCAGGGAGTCGGG - Intronic
954452722 3:50580368-50580390 GAACCGGGGCCTGAGGAGACAGG - Exonic
954798103 3:53171823-53171845 GGGCCAGGGAGTGGGCAGTCTGG + Intronic
955013388 3:55043116-55043138 GAACCTGGGAGTGGGGTTGCTGG + Intronic
956744487 3:72300660-72300682 GAATAATGGAGTGGGGAAACTGG - Intergenic
956850977 3:73228015-73228037 GAGAGAGGGAGTGGGGAGAGGGG - Intergenic
957834708 3:85572461-85572483 GAGACAGAGAGAGGGGAGACGGG + Intronic
960632867 3:119750777-119750799 GAACCAGAGAGTGGGAACAGAGG + Intronic
961386300 3:126525086-126525108 GGGCCAGAGAGTGGGGAGACAGG + Intronic
961477542 3:127158089-127158111 GGACCAGGGAGGGGAGAGGCTGG + Intergenic
961929268 3:130516636-130516658 GGACCAGAGAGTAGGGAAACTGG + Intergenic
962250241 3:133831804-133831826 GAACCAGGGAGAAGGGACATTGG - Intronic
962714662 3:138115812-138115834 GAGGCAGGGTGTGGGGAAACCGG - Intronic
963964989 3:151357595-151357617 AAACCAGGGAGAGGGAAGAAAGG - Intronic
964330738 3:155599484-155599506 AAACCAGGTTGTGGGGGGACTGG + Intronic
964556304 3:157943450-157943472 GAGGCTGGGAGTGGGGAGATGGG - Intergenic
965734715 3:171808676-171808698 TAACCAGGTAGTGGGGAACCCGG - Intronic
966777649 3:183556920-183556942 AATCCAGGGGGTGGGGAGACTGG + Intergenic
967723691 3:192841924-192841946 GAACCAGGCAGAGGGGTGAGAGG + Intronic
967930194 3:194685711-194685733 GGTCGAGGGAGCGGGGAGACCGG - Intergenic
968602932 4:1519053-1519075 GAACCAGGGTGCCGGGAGCCTGG - Intergenic
968607673 4:1543131-1543153 AAGCCAGGGAGTGGGCAGGCAGG + Intergenic
969226490 4:5801856-5801878 GAACCAGGGCATGGGGAGGCAGG + Intronic
969252754 4:5980412-5980434 AAACTACGGAGTGGGGAAACGGG - Intronic
969502588 4:7562239-7562261 GACCCAGGCTGTGGGGAGATGGG + Intronic
969700509 4:8765182-8765204 GAACCCGGCTGTGGGGAGACAGG - Intergenic
970097317 4:12478731-12478753 CTATCAGGGAGTGGGGGGACTGG + Intergenic
971503434 4:27341173-27341195 GAACCCAGGAGTGGGGAAAGTGG + Intergenic
979566333 4:122157943-122157965 AAAACAGGGACTTGGGAGACAGG - Intronic
981081800 4:140644308-140644330 ACAGCAGGGAGTGGGGAGGCAGG + Intronic
981173248 4:141649388-141649410 GCACCAGGAAGTGTGGTGACTGG + Intronic
981913326 4:150007753-150007775 GAACTAGGAAGAGGTGAGACAGG - Intergenic
982082948 4:151807948-151807970 GACCCGGGGAGTGGGGGGAGGGG - Intergenic
982184248 4:152779949-152779971 GAAGCCGGAAGTGAGGAGACCGG - Exonic
982220761 4:153123318-153123340 GAGGCAGGCAGTGGGCAGACAGG + Intergenic
984041993 4:174746479-174746501 ATACCAGGGACTGGGGAGACCGG + Intronic
984875788 4:184366239-184366261 GAACCAAGGAGAGGAGAGAAGGG + Intergenic
985658087 5:1142377-1142399 GGAGAAGGGAGAGGGGAGACAGG - Intergenic
986175698 5:5350203-5350225 GAACCGAGGAGTGGTCAGACAGG - Intergenic
986448315 5:7842535-7842557 TAGCCAGTGAGTGGGGAGAGAGG - Intronic
988978277 5:36537354-36537376 GAGCCACGCAGTGGGGAGGCAGG + Intergenic
990015835 5:51061443-51061465 GAACCAAGAAATGGGGAGATGGG + Intergenic
991092690 5:62708326-62708348 GAAAGAGTGAGTGAGGAGACAGG + Intergenic
992918994 5:81492960-81492982 GAGGCAGGGAGTGGGGATAAAGG + Intronic
994331406 5:98510543-98510565 GAAAGAGGGAGTGGGGAGAGAGG - Intergenic
995610003 5:113899132-113899154 GAAGCAAGGAGTGGAGAGGCAGG + Intergenic
997256691 5:132434460-132434482 GAGCCGGGGGGTGGGGAGACAGG - Intronic
998589188 5:143459368-143459390 GAACCAGGTAGAAGAGAGACTGG + Intergenic
999275122 5:150325091-150325113 GAAAGAGGGAGTGGGGAGGGAGG + Intronic
1000304632 5:159984175-159984197 TAACCAGGGAGTGAAGAGAAAGG - Intergenic
1001106537 5:168859162-168859184 GAAGCAGGGGGTGGAGGGACGGG + Intronic
1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG + Intronic
1001522443 5:172404219-172404241 GGACTAGGGGGTTGGGAGACTGG + Intronic
1002143377 5:177159359-177159381 GAACCAGGGAGATGGGTTACAGG - Intronic
1003098502 6:3159658-3159680 GCAGCAGGGAGAGGGGAGAGAGG - Intergenic
1005026597 6:21468281-21468303 GAACTATGAGGTGGGGAGACAGG - Intergenic
1006633091 6:35443325-35443347 GAAGAAGAGAGTGAGGAGACAGG - Intergenic
1006811175 6:36821518-36821540 GTAACAGGGAGTAGGGAGAGAGG - Intronic
1006837498 6:37007806-37007828 AAACCAGGGACTGGGGTGCCAGG + Intronic
1007019874 6:38508704-38508726 GCAGCAGTGAGAGGGGAGACTGG - Intronic
1007378519 6:41471897-41471919 GAGGCAGGGAGTGGGGAGGGGGG + Intergenic
1007508930 6:42360681-42360703 GCACCAGGCTGTGGGGAGGCTGG - Intronic
1008207586 6:48682073-48682095 GAAAAAGGGAGTTGTGAGACTGG + Intergenic
1008574730 6:52849216-52849238 GAAACAGGGAATGTGGAGAAAGG - Intronic
1008772114 6:54991869-54991891 CAAGGAGGGAGTGGGGAGAGTGG + Intergenic
1010062886 6:71645498-71645520 GAGAAAGGGAGTGGGGAGAGAGG + Intergenic
1010151080 6:72732890-72732912 GAATCAGGAAGTGGGGAAAATGG + Intronic
1010800384 6:80168332-80168354 GAAGAAGGGAGAGGGGAGAGAGG + Intronic
1013169723 6:107625654-107625676 AACCCAGGGAGTGAGGAGGCTGG + Intronic
1014567242 6:122964565-122964587 GAATTAGGGAGTGGGGACAATGG + Intergenic
1014681522 6:124436727-124436749 GAACCAGTGAGAGGCCAGACAGG - Intronic
1017301967 6:152871706-152871728 GAACTGGGGAGTGAGGAGGCAGG - Intergenic
1017868839 6:158469075-158469097 GAGCAAGGGAGAGGTGAGACAGG + Intronic
1018835759 6:167482507-167482529 GAGCCAGGGAGTGCACAGACTGG + Intergenic
1019013351 6:168860954-168860976 GCAGCAGGGAGAGGGGAGACAGG + Intergenic
1019500073 7:1360327-1360349 GACCCAGGGTGTGGGGCGTCTGG - Intergenic
1019595202 7:1855184-1855206 GAACCAAAGAGGAGGGAGACGGG - Intronic
1019918724 7:4149719-4149741 GACCCAGGGATTGGCGAGGCAGG + Intronic
1019929046 7:4211358-4211380 AGACCAGGGAGTGAGGAGGCCGG + Intronic
1020064837 7:5179881-5179903 ACCCCAGGGAGTGGGGAGAGAGG - Intergenic
1020968554 7:14903515-14903537 GTAGAAGGGAGAGGGGAGACGGG - Intronic
1021558723 7:21946968-21946990 GAAGTAGAGAGTGGGGAGAATGG + Intergenic
1021931999 7:25590180-25590202 GGGCAAGGGAGTGTGGAGACTGG + Intergenic
1022097871 7:27152050-27152072 GAGCCAGGGAGGGGAGAGAAAGG + Intronic
1022396376 7:29990691-29990713 GAACCCGGGAGGCGGGAGGCGGG - Intergenic
1022499137 7:30871645-30871667 GTACCAGGGGGTGGGGGCACAGG + Intronic
1022681154 7:32547580-32547602 GAACCAGGGAGTGGGGAGACAGG - Intronic
1023354692 7:39355077-39355099 GAACCAAGGAATAGGAAGACAGG + Intronic
1023769040 7:43537948-43537970 CAACCAGGGGGTGTGGCGACGGG - Intronic
1024232191 7:47371055-47371077 GAAGTGGGGAGTGGGGAGAGTGG + Intronic
1024919973 7:54545626-54545648 GAAAGAGGGAAGGGGGAGACGGG + Intronic
1025258085 7:57399027-57399049 GCTCCAGGGAGTCGGAAGACAGG + Intergenic
1026206011 7:68258109-68258131 GGACTACTGAGTGGGGAGACAGG + Intergenic
1027226222 7:76245273-76245295 GAAGCAGGGAGTAGAGAGATGGG + Intronic
1027429140 7:78091730-78091752 GAAGTAGGGAGTGGGGAGAAAGG + Intronic
1027605569 7:80294315-80294337 GAAAGAGGGAGTGGGGAGGGAGG - Intergenic
1029439666 7:100579995-100580017 GGGTCAGGGAGTAGGGAGACAGG + Intronic
1029659106 7:101947173-101947195 GAGCCCAGGAGTTGGGAGACCGG + Intronic
1030092996 7:105874197-105874219 GAAACAGGGACTGGGGGGAAAGG + Intronic
1030288136 7:107847558-107847580 GAAAGAGGGAGAGGGGAGAGGGG - Intergenic
1030622388 7:111804416-111804438 GTACCAGGGGCTGGGGAGACAGG + Intronic
1031085579 7:117298858-117298880 GAACCAGGGATGGGGAAGGCAGG + Intronic
1032189741 7:129757765-129757787 AAACCAGGGAGTGAGGATGCAGG - Intergenic
1033197605 7:139341122-139341144 GAACAAGGGTTTGGGGAAACAGG - Exonic
1034286696 7:149888655-149888677 GAAGGAGGAAGTGGGGAGAGAGG + Intergenic
1035245750 7:157561164-157561186 GAACCAGAGGGCGGGGAGACTGG - Intronic
1035245775 7:157561239-157561261 GAACCAGAGGGCGGGGAGACCGG - Intronic
1035662643 8:1359449-1359471 GAACGTGGGCGTGGGGACACGGG + Intergenic
1035841258 8:2813835-2813857 GAGGCAGGGAGCGGGGAGAGCGG - Intergenic
1036142736 8:6223450-6223472 GAACCACGGCCTGGGCAGACAGG + Intergenic
1036664443 8:10729906-10729928 GCCCCAGGGGGCGGGGAGACGGG - Intronic
1036726495 8:11225341-11225363 GACCCAGGAGGTGGGAAGACAGG - Intergenic
1037521230 8:19682268-19682290 AAAGCAGGGAGAGGAGAGACAGG - Intronic
1037769408 8:21789774-21789796 GAGCCGGGGGGAGGGGAGACCGG - Intronic
1037977529 8:23224356-23224378 GAATCAGGGAGTGGGGAGAATGG + Intronic
1037998557 8:23370729-23370751 CCTCCAGGGACTGGGGAGACCGG + Intronic
1038535302 8:28349225-28349247 GGACCTGGGCGTGGGGAGAGGGG + Exonic
1038922160 8:32096752-32096774 TACCCAGGGAGTGGGGAGATCGG - Intronic
1039568161 8:38565574-38565596 GAGGCAGGGAGGAGGGAGACAGG - Intergenic
1039951368 8:42175443-42175465 GAGCCAGGGAGTGGGGAAAGGGG + Exonic
1040309057 8:46227270-46227292 GAGGCAGGGAGAGGGGAGAATGG - Intergenic
1040543879 8:48381957-48381979 GAATCAGGAGGTGAGGAGACTGG - Intergenic
1040545742 8:48396855-48396877 GAACCACGGCGGGGGGAGGCCGG - Intergenic
1041187564 8:55316706-55316728 GAACCAGGTAAAGGGGAAACTGG - Intronic
1041906595 8:63039198-63039220 TAACCAGGCAGCGGGGAGGCTGG + Intergenic
1042193003 8:66207023-66207045 AAAACAGGGAGTGGGGACAGTGG - Intergenic
1042491925 8:69409479-69409501 GAACCTATGAGTTGGGAGACTGG + Intergenic
1042581573 8:70284849-70284871 GGAGAAGGGAGAGGGGAGACGGG + Intronic
1043379838 8:79690750-79690772 TAGCCAGGGTGTGGGGAGTCAGG + Intergenic
1044585965 8:93869506-93869528 GAAGTAGGGGGTGGGGGGACAGG - Intronic
1044674975 8:94719803-94719825 GAACCAGAGTGTTGGGAGAGGGG - Intronic
1045579158 8:103459805-103459827 GAGCCAGGGAGTAGAGATACTGG - Intergenic
1045910120 8:107397631-107397653 TAAGTAGGGACTGGGGAGACCGG + Intronic
1046239373 8:111470960-111470982 AAACCAGGGACAGGGAAGACTGG + Intergenic
1047750788 8:127878890-127878912 GGCTCAGGGAGTGGGGAGGCAGG - Intergenic
1049072533 8:140367897-140367919 GAAATAAGGGGTGGGGAGACAGG + Intronic
1049150993 8:141035454-141035476 GAGCCAGGCAGTGGGGAGCGAGG - Intergenic
1049217602 8:141415261-141415283 GCAGCAGGCAGTGGGGAGACAGG + Intronic
1049445829 8:142631042-142631064 ACACCAGGGAGTGGGGAGCTGGG + Intergenic
1049762856 8:144338736-144338758 GAAACGGGGGGTGGGGGGACAGG - Intergenic
1050335045 9:4582611-4582633 GAACAAGGGAGTAGGAAGGCAGG + Intronic
1050944717 9:11501773-11501795 CAACAGAGGAGTGGGGAGACAGG + Intergenic
1051215352 9:14791914-14791936 GAACCCGGGAGAGGGGGGAGAGG - Intronic
1051353336 9:16218506-16218528 CAAACAGGGAGTGGGGTGACAGG + Intronic
1052322349 9:27182042-27182064 GAATCAGGGAGTGGTTAGAAAGG + Intronic
1052399810 9:27986389-27986411 GAAGCAGGAAGTGGGGCAACGGG + Intronic
1052440091 9:28485238-28485260 GAACCAGTAAGTAGGAAGACTGG - Intronic
1053104645 9:35399320-35399342 GAAGCAGGGAGTGAGGGGAAGGG - Intronic
1053598332 9:39585741-39585763 GATAAAGGGAGTGGGGAGAAGGG - Intergenic
1053856365 9:42342750-42342772 GATAAAGGGAGTGGGGAGAAGGG - Intergenic
1053901067 9:42796007-42796029 GAACCAGGATTTGGGGAGTCAGG - Intergenic
1054260579 9:62861557-62861579 GAACCAGGATCTGGGGAGTCAGG + Intergenic
1055939541 9:81636582-81636604 GAAGCAGGGAGAGGGGTGAGAGG - Intronic
1056023742 9:82469029-82469051 TAATCAGGGGGTGGGGAGAATGG - Intergenic
1056488259 9:87080789-87080811 TAACTAGGGAGTGGGTAGGCAGG - Intergenic
1057310216 9:93938341-93938363 GGAGCAGTGAGTGGGGAGAGGGG + Intergenic
1057712546 9:97460271-97460293 GGACCAGGTAGTGGGGATAGAGG - Exonic
1057895721 9:98907008-98907030 GAGGCTGGGAGTGGGGAGGCAGG + Intergenic
1058723930 9:107784363-107784385 GAACCAGGCAGTGGGGTGGGGGG + Intergenic
1059362304 9:113754381-113754403 GAACCAGGAACTGGAGTGACTGG - Intergenic
1059426179 9:114222321-114222343 GAGCCAGCGTGTGGGGAGCCAGG + Intronic
1060295387 9:122339585-122339607 GAACCTGGGGGAGGGGAGGCAGG - Intergenic
1060667707 9:125442686-125442708 GGACCAAGGAGTGGGGACACGGG - Intronic
1060759258 9:126234448-126234470 GAACCAGAGAGAGAGGAGGCAGG + Intergenic
1060888893 9:127175876-127175898 GCACCAGAGAGTGGGGAGAGTGG - Intronic
1060909849 9:127340834-127340856 GAAGGAGTGACTGGGGAGACAGG - Intronic
1061041301 9:128142292-128142314 GAGGCAGGGTGTGGGGAGGCAGG + Intergenic
1061179281 9:129014297-129014319 CAGCCAGGGAGAGGGGAGAGAGG + Intronic
1061392976 9:130327933-130327955 GATCCTGGGAGTGGGCGGACAGG + Intronic
1061423440 9:130484434-130484456 GCAGCGGGGAGTGGGGAGACGGG - Intronic
1061472548 9:130838189-130838211 GAGCCAGTGAGTGGGGGTACTGG + Intronic
1061590659 9:131595568-131595590 GAAGCAGCGTGTGGAGAGACTGG + Intronic
1061917138 9:133761084-133761106 GGATCAGGGAGGGGGGAGCCAGG + Intergenic
1062082857 9:134633644-134633666 TTTCCAGGGAGAGGGGAGACGGG - Intergenic
1062204659 9:135329374-135329396 CAACCAGGCAGTGAGGAGAGAGG + Intergenic
1062397607 9:136358723-136358745 TGGCCGGGGAGTGGGGAGACAGG - Exonic
1062577036 9:137213692-137213714 GAACCCGGGAGAGTGGAGCCCGG - Intronic
1062584766 9:137244279-137244301 TAAACAGGAACTGGGGAGACAGG + Exonic
1186616447 X:11193424-11193446 GAACCAGGGTGTGAGGAGGACGG - Intronic
1186782215 X:12924515-12924537 TAACTAGGGAGTGGGGAAAAGGG - Intergenic
1187066010 X:15838710-15838732 GAACCAGAGAGTAAGGACACTGG + Intronic
1187254479 X:17629797-17629819 GCTCCAGGGAGTGGGGACTCAGG + Intronic
1187772200 X:22712265-22712287 GTAGCAGGGAGTGGGGAACCGGG + Intergenic
1189281789 X:39824264-39824286 GAACCAGAGGGTAGGCAGACAGG - Intergenic
1189805205 X:44728551-44728573 GAGCTGGGGAGTGGGGAAACTGG - Intergenic
1190918893 X:54831332-54831354 GCAGCAGGCAGTGGGGAGATAGG - Intergenic
1192243902 X:69357852-69357874 GAAGGAGGCAGTGGGGAGAAAGG - Intergenic
1192329770 X:70165911-70165933 GAGCCCGGGAGTGGGATGACTGG + Exonic
1193765228 X:85520253-85520275 GAACCAGGAATTGAGGACACAGG + Intergenic
1195701333 X:107707948-107707970 GTTCCAGGGAGTAGGAAGACAGG - Intergenic
1195938185 X:110145017-110145039 GCACCAGGAAGTGGGGAGATGGG + Intronic
1196783613 X:119403675-119403697 GAACGAGGAAGTGGGCAGGCAGG + Intronic
1196791479 X:119468650-119468672 CAACCAGGAAGTGGGGGGAAGGG + Intronic
1197152889 X:123239302-123239324 GAACCAGGCACTGAGGAAACAGG - Intronic
1197411787 X:126124627-126124649 CAAGGAGGGAGTGGGAAGACTGG - Intergenic
1198380334 X:136077728-136077750 GAAGCAGGGAGAGAGGAGAGAGG - Intergenic
1198462977 X:136880835-136880857 GAGCCAGCCAATGGGGAGACTGG - Intergenic
1198791321 X:140349935-140349957 GAACCAGAGTGTGAGGAGAGTGG - Intergenic
1199286124 X:146056442-146056464 GAACAAGGGAGTGGGAACACTGG + Intergenic