ID: 1022687671

View in Genome Browser
Species Human (GRCh38)
Location 7:32611829-32611851
Sequence CAGAGAAAACACACTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022687671_1022687675 9 Left 1022687671 7:32611829-32611851 CCAACCTCAGTGTGTTTTCTCTG No data
Right 1022687675 7:32611861-32611883 AACATCCAAAACCAAAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022687671 Original CRISPR CAGAGAAAACACACTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr