ID: 1022692015

View in Genome Browser
Species Human (GRCh38)
Location 7:32665423-32665445
Sequence TGGGGAAGACAGATGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022692005_1022692015 1 Left 1022692005 7:32665399-32665421 CCCTAGACAAAGGGATAGATGGG No data
Right 1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG No data
1022692007_1022692015 0 Left 1022692007 7:32665400-32665422 CCTAGACAAAGGGATAGATGGGG No data
Right 1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022692015 Original CRISPR TGGGGAAGACAGATGGGGCA AGG Intergenic
No off target data available for this crispr