ID: 1022692662

View in Genome Browser
Species Human (GRCh38)
Location 7:32672024-32672046
Sequence TCTGTGGCTAAGAAATATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022692659_1022692662 -6 Left 1022692659 7:32672007-32672029 CCTTCAGAAACTGTTAGTCTGTG 0: 2
1: 0
2: 1
3: 11
4: 199
Right 1022692662 7:32672024-32672046 TCTGTGGCTAAGAAATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022692662 Original CRISPR TCTGTGGCTAAGAAATATCA GGG Intergenic
No off target data available for this crispr