ID: 1022692765

View in Genome Browser
Species Human (GRCh38)
Location 7:32673505-32673527
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022692765_1022692773 16 Left 1022692765 7:32673505-32673527 CCTGCTTTCCACATACTAGATTT 0: 2
1: 0
2: 0
3: 11
4: 190
Right 1022692773 7:32673544-32673566 CTGGTATGCTTTTATCCTCATGG No data
1022692765_1022692768 -3 Left 1022692765 7:32673505-32673527 CCTGCTTTCCACATACTAGATTT 0: 2
1: 0
2: 0
3: 11
4: 190
Right 1022692768 7:32673525-32673547 TTTTGGCCTTTGCCTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022692765 Original CRISPR AAATCTAGTATGTGGAAAGC AGG (reversed) Intergenic
903503997 1:23819969-23819991 ATATTTAGTATGAGGAAAGTTGG - Intronic
905078458 1:35295540-35295562 AAATCTAGTAGATAGAAACCAGG - Intronic
906491905 1:46274954-46274976 AAATCATGTATGAGGGAAGCAGG - Intronic
908340368 1:63172225-63172247 AAATTAAGGATGTGGAATGCTGG - Intergenic
912482139 1:109991258-109991280 AAAGGTAGTATTTGGAAATCTGG + Intronic
913136074 1:115890484-115890506 AAATCAAGTTTGCGGAAAGGAGG - Intergenic
914220020 1:145672861-145672883 ACTTCTAGTCTGTGGAAAGAAGG - Exonic
914472600 1:147995727-147995749 ACTTCTAGTCTGTGGAAAGAAGG - Intergenic
915408762 1:155683825-155683847 AAATCTTGGATTTGGTAAGCAGG + Intronic
916011629 1:160711567-160711589 AGATCTGGTGTCTGGAAAGCAGG - Intronic
916334654 1:163656720-163656742 AAATCTATTTTATGGAAAGTGGG + Intergenic
917394974 1:174583731-174583753 AAGTCTAGTATCTGGAAACTGGG - Intronic
918206504 1:182314384-182314406 AAATCCAGTATCTGGAAGGAAGG - Intergenic
918571110 1:185994210-185994232 AATGCAAGTATGTGGAAATCAGG + Intronic
919135418 1:193501748-193501770 AAACGTAGTGTGTGGAAAGTAGG + Intergenic
919544712 1:198900691-198900713 AAATTTAGAATGTGAAAAGTTGG - Intergenic
920015937 1:202908514-202908536 AAATCTAGTACGAGGTAAACTGG + Intronic
921752785 1:218816711-218816733 AAATCAAGTATGTAAAAGGCAGG + Intergenic
921904981 1:220486722-220486744 GCATCTAGTAGGTAGAAAGCAGG - Intergenic
923988018 1:239403299-239403321 AAGTCTATTATGTGCCAAGCAGG - Intronic
1063274132 10:4545655-4545677 TAATATAGTATGTGGATAACTGG + Intergenic
1063850038 10:10177612-10177634 GAATCTATTAAGTGGAAAGAAGG - Intergenic
1064031159 10:11883949-11883971 AAATCCAGTAAGTGAACAGCTGG + Intergenic
1064242579 10:13644610-13644632 AAATCTAGTCTGGAGAAAACTGG - Exonic
1065043210 10:21718184-21718206 AAAACTAGTCTGTTGAAAGGGGG - Intronic
1065485360 10:26231699-26231721 AAATCTAAAATGGGAAAAGCAGG + Intronic
1068076554 10:52263218-52263240 AAATCTAGTTTGTGGCTAACTGG + Intronic
1068121961 10:52790004-52790026 AAATCTATTAAGTGGAAAATGGG - Intergenic
1068341929 10:55715562-55715584 AAATCTAAGAAGTGGAAAACAGG - Intergenic
1071139444 10:82490629-82490651 AAGTCTAGAGTTTGGAAAGCAGG - Intronic
1071773023 10:88751336-88751358 AAATCTAGGATGTAGAAATTTGG + Intronic
1071849631 10:89555757-89555779 AAATGTAGTCTTAGGAAAGCAGG - Intronic
1072881399 10:99232937-99232959 AAAACTTGTATGCTGAAAGCCGG + Intronic
1073939655 10:108681262-108681284 AAAGCCAGTATGTGTAAAGTGGG - Intergenic
1076038901 10:127226445-127226467 ATAAATAGTATGTGGGAAGCTGG + Intronic
1076051629 10:127338496-127338518 AAAATTAGCATGTGGAAAGTAGG + Intronic
1076226452 10:128780187-128780209 CACTCCAGTGTGTGGAAAGCAGG + Intergenic
1078026308 11:7698889-7698911 AAATCTTATCTGTGGAAAGAAGG + Intronic
1078955982 11:16195779-16195801 AAATATTGTATCTGGAATGCTGG - Intronic
1079306968 11:19331945-19331967 ATATCTAGTACGTGGTTAGCTGG + Intergenic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1079606915 11:22381168-22381190 AAATGTAGTATTTGGAGAGTCGG + Intergenic
1080732714 11:34976430-34976452 AAATCTAACATGTGTAAAGTAGG - Intronic
1081942099 11:46952153-46952175 AAATCCAGGATGTGAAAGGCAGG + Intronic
1082757039 11:57087524-57087546 AAATATAGTATATAAAAAGCTGG - Intergenic
1086436384 11:86785112-86785134 AAATCCAGTATGTGAAAATGGGG + Intergenic
1087602635 11:100336224-100336246 TAATCTAATATGTGGAAAACAGG + Intronic
1087955267 11:104278541-104278563 AAATAGAGTATGTGGACAGACGG + Intergenic
1090761775 11:129843355-129843377 GAATCCAGGATGCGGAAAGCTGG - Intronic
1091854743 12:3730394-3730416 AGTTCTAGTATGTGGACAACTGG - Intronic
1093170201 12:15851769-15851791 AAGTCTAGTGTGTGTAAACCTGG - Intronic
1093418489 12:18947618-18947640 AAATATAGTATGTGTATATCTGG - Intergenic
1094642553 12:32290171-32290193 ACATATAGTAGGTTGAAAGCAGG + Intronic
1094729603 12:33159423-33159445 AAAAGTAGTAAGTGCAAAGCCGG - Intergenic
1095811552 12:46377220-46377242 AAATCTAATATGTAGACAACAGG - Intergenic
1096766029 12:53890603-53890625 AAGTCTAGGATGTGAAAGGCAGG - Intergenic
1096850900 12:54436006-54436028 AGATTTAGTGTGTGGATAGCAGG - Intergenic
1098671983 12:73242263-73242285 CAATCTAATATTTGGAGAGCGGG + Intergenic
1099417267 12:82406445-82406467 AAATATATTATGTGGAAAAAAGG - Intronic
1099963232 12:89416988-89417010 AAAACTACTATGTGGAAAGAAGG - Intergenic
1100545172 12:95595056-95595078 ACATCTAGTAAGTGCAGAGCAGG + Intergenic
1101082123 12:101197556-101197578 AAACCTAGAATCTGGAAAACTGG + Intronic
1101356867 12:103987315-103987337 AAATATAGTATATAAAAAGCTGG - Exonic
1101653938 12:106703294-106703316 CCATCTACAATGTGGAAAGCCGG - Intronic
1104061420 12:125271643-125271665 AAACCTACTATGTGCACAGCTGG + Intronic
1106677644 13:31978075-31978097 AAAACAAGTATGTGGACTGCAGG - Intergenic
1107005702 13:35608556-35608578 ACAACTAGTATGTGCCAAGCAGG - Intronic
1108125269 13:47235961-47235983 AAATGTTGCATGTTGAAAGCTGG - Intergenic
1108130865 13:47298859-47298881 AAATATAGTAAGTGAAAAACAGG + Intergenic
1108607322 13:52052627-52052649 ATATTTAATATGTGAAAAGCAGG - Intronic
1108991729 13:56666940-56666962 CTATCTAGGATGTGGAAAGATGG - Intergenic
1109421687 13:62120806-62120828 AAATCCAATATGTGACAAGCAGG - Intergenic
1109634038 13:65090000-65090022 ATATCTACTATGAGGAAGGCAGG - Intergenic
1114859700 14:26500104-26500126 TAATCTAGACTGTGGAAACCAGG - Intronic
1116682599 14:47993359-47993381 AAATCTAGTAGATAAAAAGCAGG - Intergenic
1117187117 14:53251296-53251318 AAACTTAGTATGTCCAAAGCTGG + Intergenic
1117457874 14:55915785-55915807 AAATCTGTTATGTGTGAAGCTGG - Intergenic
1118043080 14:61938356-61938378 ACATCTCGTATCTGGCAAGCTGG - Intergenic
1120123620 14:80713668-80713690 CAATCTACTATGTGCAAAACAGG - Intronic
1125091576 15:35799074-35799096 AAATCAGGGATGTAGAAAGCTGG - Intergenic
1125097893 15:35875751-35875773 ACATCTTGTATCTGGAAAGAGGG - Intergenic
1125197462 15:37063725-37063747 AAAGCTAGTATCTGGAAAGATGG + Intronic
1125883586 15:43212716-43212738 AACCCTAGGATGAGGAAAGCAGG - Intronic
1126712373 15:51473219-51473241 AAATGGAGTAAGTGGAAAGACGG - Intronic
1130158243 15:81372236-81372258 AAATCTAGTGTTTAGAAAGGAGG + Intronic
1133041617 16:3063987-3064009 ACATCCTGTATGTGGAAAGGCGG + Intergenic
1134870011 16:17644109-17644131 AAATCTATTATGTGACAAGCTGG - Intergenic
1139615546 16:68086488-68086510 AAATCTTGAATTGGGAAAGCTGG + Intronic
1140896085 16:79325483-79325505 ACAGCTAGTAAGTGGAAAGCAGG + Intergenic
1141856270 16:86683293-86683315 AAACCAAGTCTGTGGAAAGGTGG + Intergenic
1144078714 17:11742940-11742962 AAAAGTAGTATGAGGAAAACAGG - Intronic
1146109886 17:30079329-30079351 AGATCTTGTATGTGGAAAGAAGG + Intronic
1147962225 17:44174806-44174828 AAATTTAGTATTTGGAAGCCGGG + Intronic
1153161223 18:2206632-2206654 AAAGCCTGTATGTGGAAATCTGG - Intergenic
1153421494 18:4911255-4911277 ATATCCAGTATTTGGAGAGCCGG - Intergenic
1154246128 18:12701463-12701485 ACATCTACTAAGTTGAAAGCTGG - Intronic
1157148335 18:45189116-45189138 AAAGCTAGTAAGTGGCAAACTGG + Intergenic
1157364591 18:47052735-47052757 AAAACTAGTATGTGCATAGGAGG - Intronic
1158052648 18:53241767-53241789 AAGTCTGGTATGGGGAAGGCAGG + Intronic
1160258655 18:77269402-77269424 ATATCTATTAAGTGGAAAGAAGG + Exonic
1162668367 19:12234575-12234597 AAATTTGGAATGTGGAAAGGAGG - Intronic
1163041325 19:14604913-14604935 AATTCCAGGATGTGGAAAGCTGG + Intronic
1168404846 19:56105300-56105322 AACCCCAGCATGTGGAAAGCTGG - Intronic
925795750 2:7540487-7540509 AAATAAAGAATGAGGAAAGCAGG - Intergenic
926376254 2:12230974-12230996 AAATCTAGGATGTGGCATGGAGG - Intergenic
926988045 2:18645564-18645586 GTCACTAGTATGTGGAAAGCAGG - Intergenic
930915352 2:56680187-56680209 AAATGTAGAATCTGGACAGCAGG + Intergenic
932112094 2:69011124-69011146 AGAGCTTGAATGTGGAAAGCGGG - Intergenic
932515092 2:72338110-72338132 AGAGCTACTAAGTGGAAAGCTGG - Intronic
933624906 2:84587314-84587336 AAATCTGGTATGTGGACACACGG - Intronic
937771812 2:125728282-125728304 AAATGTAGGAGGTGGAAATCTGG - Intergenic
940325945 2:152424811-152424833 AAAGTGAGTATGTGGAATGCAGG + Intronic
940766502 2:157795830-157795852 AAATGTAGTATGAGGAGAGAAGG - Intronic
941235572 2:162968298-162968320 AATTCTAGAATGTTTAAAGCTGG + Intergenic
942346487 2:175007736-175007758 CAAACTAGTGAGTGGAAAGCTGG - Intergenic
942518273 2:176775983-176776005 ATAGCTAGTAGGTGGCAAGCAGG + Intergenic
946109699 2:217403758-217403780 AAAGCTAGTAAGTGCAGAGCTGG + Intronic
1172160119 20:32862098-32862120 AAAACAAGTATCTGGAAATCTGG - Intronic
1176974367 21:15302188-15302210 GTATCTAGTATGTGGAAAATAGG + Intergenic
953108102 3:39905613-39905635 AAAGCTATTATAGGGAAAGCTGG - Intronic
954357620 3:50095556-50095578 AAGTCCAGGATGTGGAAAGTAGG - Intronic
955073988 3:55595597-55595619 AAATCTGTTATGATGAAAGCCGG + Intronic
959859621 3:111202630-111202652 CATTCTAGTAAGTGGAAAGTGGG + Intronic
960189257 3:114683711-114683733 AAATCTAGGATGGGGAGAGTGGG - Intronic
961305238 3:125954728-125954750 ACATCTACTATGTGCTAAGCAGG - Intergenic
962675022 3:137749660-137749682 AAATCAAGTAAGTGGAAAATGGG + Intergenic
963672201 3:148265879-148265901 AAATCTTGTACCTGGAAAACTGG - Intergenic
964219378 3:154326421-154326443 AAATGGAGTATCTAGAAAGCAGG + Intergenic
965157307 3:165080287-165080309 AATTCAAAGATGTGGAAAGCTGG - Intergenic
965316775 3:167201388-167201410 CATTTTAGTATGTGGAAAGAAGG - Intergenic
967355048 3:188559877-188559899 AAAGCTGCTATGTGAAAAGCTGG - Intronic
969031395 4:4217885-4217907 CAATCAACTTTGTGGAAAGCTGG + Intronic
969882551 4:10187120-10187142 AAATCTGGGATTTGGAGAGCTGG + Intergenic
970155474 4:13137287-13137309 AAAGCAAGTATGGGGAAAGAAGG + Intergenic
971295574 4:25386762-25386784 AAATGCAGTATCTGGGAAGCAGG + Intronic
973634379 4:52848463-52848485 AAATCACCTAAGTGGAAAGCAGG - Intergenic
974017987 4:56666579-56666601 TAATCTTGTATGTGGAAACCTGG + Intronic
974152939 4:58032983-58033005 ATATCTATTTTGTGGAGAGCAGG + Intergenic
974273974 4:59690847-59690869 AAATCCAGAATGAGGGAAGCAGG - Intergenic
974795788 4:66747381-66747403 AAATCATGTATGTGAAAATCAGG + Intergenic
977984595 4:103367200-103367222 AAATATAGAATGTGGAAATGGGG + Intergenic
978581613 4:110237207-110237229 AAATCTATTCTGTTGAAGGCAGG - Intergenic
978595807 4:110375733-110375755 AAACTTAGTATGTCCAAAGCTGG - Intronic
980881450 4:138713901-138713923 ATATCTGGTAGGTAGAAAGCAGG - Intergenic
982037623 4:151362036-151362058 GAATCTAGTATGTTCAAAGGAGG - Intergenic
982989144 4:162248540-162248562 AAATGTAGTATGATAAAAGCGGG - Intergenic
983004108 4:162461315-162461337 AAATCTAGTGAGTAGAAAGATGG + Intergenic
983090238 4:163494248-163494270 TAATCTAGTACGTGGAAAAGCGG + Intergenic
984835209 4:184013071-184013093 AAAACGAGCATGTGAAAAGCAGG - Intronic
984920073 4:184755988-184756010 AATTCTAGGATGTAGAAATCTGG - Exonic
992763379 5:79971626-79971648 ATATCTAATATGTGAAAATCGGG + Intergenic
993415149 5:87618980-87619002 AATTTTTGTATGTGGAAAGGAGG + Intergenic
997217225 5:132122856-132122878 AATTGCAGGATGTGGAAAGCTGG + Intergenic
999081486 5:148848342-148848364 AAATGTAGAAAGAGGAAAGCTGG - Intergenic
999859588 5:155631478-155631500 ATATTTAGTATGTGGATGGCAGG + Intergenic
1000337716 5:160253954-160253976 GAATCTAGTTTGTGAACAGCTGG - Intronic
1004016971 6:11740849-11740871 AAATCTGATATCTGGAAATCTGG + Intronic
1005711361 6:28505933-28505955 AAAGATAGTCTGTGGGAAGCAGG + Intronic
1005714531 6:28534321-28534343 AAATCTAGTTTGTGGAGAGTGGG - Exonic
1008942178 6:57059097-57059119 AAATCAAGTATGATGAAAACAGG + Intergenic
1010059807 6:71609427-71609449 AATTCTAGAATGTAGACAGCAGG + Intergenic
1010283109 6:74042789-74042811 AAAAAGGGTATGTGGAAAGCTGG + Intergenic
1014811153 6:125887237-125887259 TAATCAAGTATGTGGAAAGTTGG + Intronic
1017959001 6:159205568-159205590 AAATCTGGTATTTGGAAGACAGG - Intronic
1020849457 7:13332606-13332628 AAGTCTAGTATGTTTCAAGCTGG - Intergenic
1022692765 7:32673505-32673527 AAATCTAGTATGTGGAAAGCAGG - Intergenic
1022920442 7:35008039-35008061 AAATCTAGTATGTGGAAAGCAGG - Intronic
1023148838 7:37180311-37180333 AAGTTTAGCATGTGGAAATCAGG + Intronic
1027579193 7:79972185-79972207 AAATTTAATATGTTGGAAGCAGG - Intergenic
1027632469 7:80623673-80623695 TATTCCAGTTTGTGGAAAGCTGG - Intronic
1028306212 7:89268692-89268714 AAATCCAGTATGTGAAAATGGGG + Intronic
1029667371 7:102004422-102004444 AAATCAAGTATGTGGGAGGAGGG - Intronic
1030060220 7:105615728-105615750 AAATGTAGGATGTGGACAGGAGG + Intronic
1032088171 7:128894364-128894386 ACATCTAATAAGTGGATAGCTGG - Intronic
1035554275 8:554210-554232 AAATCTAGTATGTGTTATGCAGG + Intergenic
1035715411 8:1750551-1750573 AAATCTAGAATGTGGACAATTGG - Intergenic
1036797346 8:11765880-11765902 AGAGCTAGTAAGTGGAAATCAGG + Intergenic
1037275193 8:17171011-17171033 ATAGCCATTATGTGGAAAGCAGG + Intronic
1038097257 8:24328366-24328388 CTATCTAGGATGTAGAAAGCTGG - Intronic
1040381041 8:46873144-46873166 AAGTAGAGAATGTGGAAAGCAGG + Intergenic
1041521216 8:58758269-58758291 AAATCTATTTTCTGTAAAGCAGG + Intergenic
1042146272 8:65733357-65733379 CAATCTGGTAAGTGGAAAGATGG - Intronic
1042278223 8:67027798-67027820 ATATCTAGAAGGTGGAAAGTAGG - Intronic
1045579407 8:103462439-103462461 CCATCTAGAATGTAGAAAGCTGG - Intergenic
1047805498 8:128355338-128355360 TAATCTAGTAGGTGGACAGGTGG - Intergenic
1051102884 9:13542287-13542309 AAATGTAGTCTGTGGAAAAGAGG - Intergenic
1058647116 9:107141007-107141029 AAATGTACAGTGTGGAAAGCGGG + Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1060045860 9:120339842-120339864 AAATCAAGGATCTGGGAAGCTGG + Intergenic
1186370917 X:8946525-8946547 AAATCAGGTATGTGGAGGGCTGG + Intergenic
1188279319 X:28244940-28244962 AAATCTAGCCAATGGAAAGCAGG - Intergenic
1188671141 X:32883498-32883520 AAATTTAATTTGTGAAAAGCTGG - Intronic
1189264892 X:39707005-39707027 AAATTTAAAATATGGAAAGCAGG + Intergenic
1193552659 X:82916801-82916823 AAATCTTGTGTGTTCAAAGCTGG + Intergenic
1194635409 X:96340703-96340725 AAATATACAAAGTGGAAAGCTGG - Intergenic
1195402351 X:104474876-104474898 GACTTTAATATGTGGAAAGCGGG - Intergenic
1196530415 X:116779966-116779988 AAATTCAGCATGTGGGAAGCAGG - Intergenic
1197156966 X:123281414-123281436 AATTCTAGTATTTGAAAAGAAGG + Intronic
1197376250 X:125685296-125685318 ATATTTAATATGTGAAAAGCAGG - Intergenic
1197454908 X:126667132-126667154 AAATCTATCAGGTGGAAAGAAGG + Intergenic
1197537025 X:127702809-127702831 CATTCTAGTATGTGGAATCCTGG + Intergenic
1199503233 X:148533017-148533039 CAATCCATTATGTGGAAACCAGG + Intronic
1201613261 Y:15866644-15866666 AAATGCAGTATGTGGATGGCAGG + Intergenic