ID: 1022694424

View in Genome Browser
Species Human (GRCh38)
Location 7:32690243-32690265
Sequence CCCTCCTACTCACCTTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022694416_1022694424 5 Left 1022694416 7:32690215-32690237 CCACATCCCTCATCTTTCACCAT No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694417_1022694424 -1 Left 1022694417 7:32690221-32690243 CCCTCATCTTTCACCATCCCTCC No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694409_1022694424 28 Left 1022694409 7:32690192-32690214 CCCCCACTTACGTCCTTTTCCCT No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694411_1022694424 26 Left 1022694411 7:32690194-32690216 CCCACTTACGTCCTTTTCCCTCC No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694415_1022694424 8 Left 1022694415 7:32690212-32690234 CCTCCACATCCCTCATCTTTCAC No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694418_1022694424 -2 Left 1022694418 7:32690222-32690244 CCTCATCTTTCACCATCCCTCCC No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694414_1022694424 9 Left 1022694414 7:32690211-32690233 CCCTCCACATCCCTCATCTTTCA No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694412_1022694424 25 Left 1022694412 7:32690195-32690217 CCACTTACGTCCTTTTCCCTCCA No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694410_1022694424 27 Left 1022694410 7:32690193-32690215 CCCCACTTACGTCCTTTTCCCTC No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data
1022694413_1022694424 15 Left 1022694413 7:32690205-32690227 CCTTTTCCCTCCACATCCCTCAT No data
Right 1022694424 7:32690243-32690265 CCCTCCTACTCACCTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022694424 Original CRISPR CCCTCCTACTCACCTTCTTC AGG Intergenic