ID: 1022694655

View in Genome Browser
Species Human (GRCh38)
Location 7:32692480-32692502
Sequence CTCACTACACAGAGATGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022694655_1022694662 10 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694662 7:32692513-32692535 GTAAAACTGGAACGGGTGAAGGG No data
1022694655_1022694660 3 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694660 7:32692506-32692528 AACTTATGTAAAACTGGAACGGG No data
1022694655_1022694661 9 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694661 7:32692512-32692534 TGTAAAACTGGAACGGGTGAAGG No data
1022694655_1022694665 25 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694665 7:32692528-32692550 GTGAAGGGGTGAAACTAGGAAGG No data
1022694655_1022694658 -3 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694658 7:32692500-32692522 GAGGAAAACTTATGTAAAACTGG No data
1022694655_1022694659 2 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694659 7:32692505-32692527 AAACTTATGTAAAACTGGAACGG No data
1022694655_1022694664 21 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694664 7:32692524-32692546 ACGGGTGAAGGGGTGAAACTAGG No data
1022694655_1022694663 11 Left 1022694655 7:32692480-32692502 CCACACCATCTCTGTGTAGTGAG No data
Right 1022694663 7:32692514-32692536 TAAAACTGGAACGGGTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022694655 Original CRISPR CTCACTACACAGAGATGGTG TGG (reversed) Intergenic
No off target data available for this crispr