ID: 1022698029

View in Genome Browser
Species Human (GRCh38)
Location 7:32728753-32728775
Sequence GGGCGGCGCCGCGGTGGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 1, 2: 5, 3: 59, 4: 484}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022698016_1022698029 16 Left 1022698016 7:32728714-32728736 CCCGGCTCAGGTGCCCAGCGCTC 0: 1
1: 2
2: 1
3: 24
4: 298
Right 1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG 0: 1
1: 1
2: 5
3: 59
4: 484
1022698018_1022698029 3 Left 1022698018 7:32728727-32728749 CCCAGCGCTCACCAGCCCAGCGC 0: 1
1: 1
2: 4
3: 11
4: 231
Right 1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG 0: 1
1: 1
2: 5
3: 59
4: 484
1022698023_1022698029 -8 Left 1022698023 7:32728738-32728760 CCAGCCCAGCGCCTCGGGCGGCG No data
Right 1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG 0: 1
1: 1
2: 5
3: 59
4: 484
1022698017_1022698029 15 Left 1022698017 7:32728715-32728737 CCGGCTCAGGTGCCCAGCGCTCA 0: 1
1: 2
2: 0
3: 17
4: 173
Right 1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG 0: 1
1: 1
2: 5
3: 59
4: 484
1022698019_1022698029 2 Left 1022698019 7:32728728-32728750 CCAGCGCTCACCAGCCCAGCGCC 0: 1
1: 1
2: 2
3: 33
4: 322
Right 1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG 0: 1
1: 1
2: 5
3: 59
4: 484
1022698014_1022698029 29 Left 1022698014 7:32728701-32728723 CCGCGGGGAGGTTCCCGGCTCAG No data
Right 1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG 0: 1
1: 1
2: 5
3: 59
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022698029 Original CRISPR GGGCGGCGCCGCGGTGGCCC CGG Intergenic