ID: 1022699661

View in Genome Browser
Species Human (GRCh38)
Location 7:32747421-32747443
Sequence TAGGAAATACATAATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022699653_1022699661 11 Left 1022699653 7:32747387-32747409 CCATATTCCAGGAAGTAGGCACC No data
Right 1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG No data
1022699658_1022699661 -10 Left 1022699658 7:32747408-32747430 CCTGGGATACAGATAGGAAATAC No data
Right 1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG No data
1022699656_1022699661 4 Left 1022699656 7:32747394-32747416 CCAGGAAGTAGGCACCTGGGATA No data
Right 1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022699661 Original CRISPR TAGGAAATACATAATGGGCA TGG Intergenic
No off target data available for this crispr