ID: 1022703703

View in Genome Browser
Species Human (GRCh38)
Location 7:32784257-32784279
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022703703_1022703705 -9 Left 1022703703 7:32784257-32784279 CCATCAGGCTGCTACAAGGAATT 0: 2
1: 0
2: 1
3: 11
4: 149
Right 1022703705 7:32784271-32784293 CAAGGAATTCAAAGATTCCTGGG No data
1022703703_1022703708 12 Left 1022703703 7:32784257-32784279 CCATCAGGCTGCTACAAGGAATT 0: 2
1: 0
2: 1
3: 11
4: 149
Right 1022703708 7:32784292-32784314 GGTAGAGACCTGATGAAAATGGG No data
1022703703_1022703709 18 Left 1022703703 7:32784257-32784279 CCATCAGGCTGCTACAAGGAATT 0: 2
1: 0
2: 1
3: 11
4: 149
Right 1022703709 7:32784298-32784320 GACCTGATGAAAATGGGCACCGG No data
1022703703_1022703707 11 Left 1022703703 7:32784257-32784279 CCATCAGGCTGCTACAAGGAATT 0: 2
1: 0
2: 1
3: 11
4: 149
Right 1022703707 7:32784291-32784313 GGGTAGAGACCTGATGAAAATGG No data
1022703703_1022703704 -10 Left 1022703703 7:32784257-32784279 CCATCAGGCTGCTACAAGGAATT 0: 2
1: 0
2: 1
3: 11
4: 149
Right 1022703704 7:32784270-32784292 ACAAGGAATTCAAAGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022703703 Original CRISPR AATTCCTTGTAGCAGCCTGA TGG (reversed) Intergenic
909072281 1:71010317-71010339 AATTCACTTTATCAGCCTGATGG + Intronic
914347964 1:146815935-146815957 AATTTGTTGTAGCAGCCTTGGGG - Intergenic
917263970 1:173199777-173199799 AATTCTTTGAATCAGTCTGATGG + Intronic
924078704 1:240369651-240369673 AATTCCTTTCAGCCGCCTGGAGG + Intronic
1063700295 10:8377988-8378010 AATTCCTTGTAGGATTCAGATGG + Intergenic
1063903331 10:10758355-10758377 AATTCCTTATAGAACTCTGAAGG - Intergenic
1066091218 10:32023026-32023048 TTTTCCTTACAGCAGCCTGAGGG - Exonic
1066584433 10:36917166-36917188 AAGTCATTGTAGCAGCCCTATGG + Intergenic
1068470593 10:57457308-57457330 AATTACTTGTAACAGAGTGAAGG - Intergenic
1068658437 10:59598013-59598035 AATTGCTTGGAGGATCCTGATGG - Intergenic
1070852814 10:79581907-79581929 ATTTTGTTATAGCAGCCTGAAGG - Intergenic
1071153555 10:82664114-82664136 AATTCCTTTTAGAAGCATGGGGG - Intronic
1071875080 10:89836615-89836637 AAGTCCTTATAGAAGCCTAAAGG + Intergenic
1072707128 10:97688708-97688730 AATTCCTTGTTGCAGCGTGAAGG + Intergenic
1072712253 10:97723482-97723504 AAATCCTTGAAGCAGCATGGTGG - Intergenic
1073080884 10:100859916-100859938 ATTCTCTTATAGCAGCCTGATGG - Intergenic
1074496482 10:113984082-113984104 AATTCCTTGTATCTGACTGCTGG + Intergenic
1074519340 10:114203769-114203791 AATTGCTAGTTGTAGCCTGATGG + Intronic
1076749284 10:132534222-132534244 CATTCCATGTAGCAGCATGGAGG + Intergenic
1080174485 11:29345412-29345434 ATTTTGTTTTAGCAGCCTGAGGG + Intergenic
1085736370 11:79042646-79042668 ATTTTGTTATAGCAGCCTGAAGG + Intronic
1087726475 11:101723272-101723294 ACTTCATTATAGCAGCCTGAAGG + Intronic
1088079027 11:105887415-105887437 AATTCCATGTAGAATCATGATGG - Intronic
1088994179 11:114982164-114982186 AAATCCTTGGATCAGCATGAGGG - Intergenic
1089879543 11:121760447-121760469 AATGCCTTCAAGCATCCTGAGGG - Intergenic
1092263970 12:6967405-6967427 AGTTCCTGGCAGCAGCCTGCAGG - Intronic
1093581740 12:20791245-20791267 CATTTCTGGCAGCAGCCTGAGGG - Intergenic
1096758257 12:53818002-53818024 ATTTCCTTGTAGCAGCAAAAGGG + Intergenic
1097649559 12:62280366-62280388 ACTTTGTTATAGCAGCCTGAAGG - Intronic
1097870084 12:64594589-64594611 ATTTCCTTATAGCAGCATGTTGG - Intergenic
1107455381 13:40550047-40550069 ATTTTATTATAGCAGCCTGAAGG - Intergenic
1108506483 13:51116946-51116968 AGTTCCTAGTTTCAGCCTGAAGG - Intergenic
1111249685 13:85587041-85587063 AATTACTTGTTACAGCCTCATGG + Intergenic
1113568772 13:111338795-111338817 AATTCCTTACATCAACCTGACGG + Intronic
1115720041 14:36150505-36150527 ATTTTGTTATAGCAGCCTGAAGG + Intergenic
1116121542 14:40726941-40726963 AATTCCTTGTAGCATTTTTATGG + Intergenic
1118663765 14:68044023-68044045 CATGCTTTGTTGCAGCCTGATGG - Intronic
1125414938 15:39442479-39442501 AATTCCATCTAGCAGAGTGAAGG - Intergenic
1126116380 15:45211418-45211440 AATACCTTGAAGAAGCCTCAGGG + Intergenic
1127942658 15:63715354-63715376 AATTCCTGGAAGCAGACTGAAGG - Intronic
1131315468 15:91332872-91332894 AATGCCTTATAGCAGCCAGGAGG + Intergenic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1133611832 16:7440814-7440836 AATTCCTTGTAGCCCCCTTGAGG - Intronic
1136106231 16:28031936-28031958 AATTCCTTGTTGGAGCCCCAGGG - Intronic
1139792157 16:69447138-69447160 TTTTCCTTGTAGCACCCTGGAGG + Exonic
1140443924 16:75008831-75008853 ATATCCTTGCAGCAGCCTTATGG - Intronic
1141304931 16:82853645-82853667 GAATCTTTGTAGCAGGCTGATGG + Intronic
1142739921 17:1925916-1925938 AATTCCCTGTGGCAGCCTCGTGG + Intergenic
1144150086 17:12434842-12434864 AATTCTTTTTAGCATCGTGATGG + Intergenic
1146809289 17:35890565-35890587 AAGACCTTGTAGCAGGCTCAGGG + Intergenic
1147339168 17:39743668-39743690 ATTTCCTTGTAAAAACCTGAGGG + Intronic
1147770795 17:42866679-42866701 GAATCCTAGCAGCAGCCTGAGGG - Intergenic
1149048525 17:52276785-52276807 AACTCCAGGTAGCAGCCTGTAGG + Intergenic
1152026872 17:77815612-77815634 AGTTTCTCGTGGCAGCCTGAGGG + Intergenic
1154251783 18:12750919-12750941 AATCCCTGGGAGCAGCCTTAGGG - Intergenic
1156427864 18:37035218-37035240 AATACCTTCTAGCATCATGATGG - Intronic
1156590759 18:38485254-38485276 AATTACTTGTTGCAGTCGGATGG - Intergenic
1156822260 18:41387308-41387330 AATTCTTTGTAGTTGTCTGATGG + Intergenic
1156827410 18:41448274-41448296 AGTTCCTCCTATCAGCCTGATGG - Intergenic
1158307760 18:56125392-56125414 AATTCCTGTGAGCAGCCTGTTGG - Intergenic
1160245290 18:77153791-77153813 ATTTTGTTGTAGCAACCTGATGG + Intergenic
1164446127 19:28318919-28318941 ACTTCCTTCTAGCACCCAGATGG - Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164954781 19:32372890-32372912 ACTTTGTTATAGCAGCCTGAAGG - Intronic
1165778528 19:38418698-38418720 AAGGACATGTAGCAGCCTGAGGG - Intronic
929783866 2:44975274-44975296 ATTTTGTTATAGCAGCCTGAGGG + Intergenic
931402624 2:61944948-61944970 AATTCCTTGCAGCAGCAAAAAGG - Intronic
935626734 2:105177848-105177870 GATTTGTTTTAGCAGCCTGAAGG - Intergenic
938276491 2:130029812-130029834 ACCTCCATGTAGCAGCCAGAGGG + Intergenic
938327450 2:130420572-130420594 ACCTCCATGTAGCAGCCAGAGGG + Intergenic
938362493 2:130700905-130700927 ACCTCCATGTAGCAGCCAGAGGG - Intergenic
938438881 2:131307545-131307567 ACCTCCATGTAGCAGCCAGAGGG - Intronic
939564293 2:143768477-143768499 AATTCCCTGGAGCAGCATTAAGG - Intergenic
940038888 2:149338717-149338739 ATTTTATTATAGCAGCCTGATGG + Intronic
940109987 2:150141392-150141414 AATTTATTGTAACAGCCTGAGGG - Intergenic
941005067 2:160239585-160239607 AATTCCTTTGAGAAGCCTGGAGG + Intronic
941254592 2:163212920-163212942 CATTCCATGTAGCAGCAGGATGG + Intergenic
941852458 2:170197353-170197375 CATTCCCTGTAACTGCCTGATGG - Intronic
942845263 2:180416847-180416869 TATTCTTTTTAGCAGCCTGATGG - Intergenic
945146860 2:206747617-206747639 CCTTCCTTGTGGCACCCTGAGGG - Intronic
947756701 2:232571181-232571203 AGTGCCTTGTAGCACACTGAGGG - Intronic
1169009292 20:2236960-2236982 CCTTCCTTGTAGCTGCCTGTGGG + Intergenic
1169870027 20:10240139-10240161 ACTTCCTTGCATCACCCTGAGGG + Intronic
1170477698 20:16732293-16732315 AAATCCTTGTAGCTGTCTCAAGG - Exonic
1172107088 20:32523241-32523263 AAGTCCTTGGAACTGCCTGAGGG + Intronic
1174184221 20:48694247-48694269 ATTTTGTTATAGCAGCCTGAAGG + Intronic
1174679770 20:52394971-52394993 AATTCCCAGTATCATCCTGAAGG - Intergenic
1175170909 20:57080959-57080981 TATTCCTTGGAGCAGCCAGAAGG - Intergenic
1176123062 20:63462645-63462667 AATTCCTAGAAGCTGCCTGGTGG - Intronic
1177471951 21:21570819-21570841 AATTTCTTCTATCTGCCTGAAGG + Intergenic
949113912 3:296617-296639 GACTCATTGCAGCAGCCTGAAGG + Intronic
949864378 3:8535353-8535375 TATTCCCTGCAGCACCCTGAGGG + Intronic
950725905 3:14916891-14916913 AATACCTTATAGCAGCCAGAAGG - Intronic
950763909 3:15259138-15259160 AATTCCTTGAAGTAGAATGATGG - Intronic
951358413 3:21696680-21696702 AATGCATTGTAGAAGCTTGATGG - Intronic
953998103 3:47536180-47536202 AATCCCTTGTGCCAGCCTGTGGG + Intergenic
955340062 3:58118296-58118318 AAATCCCTGTTGCAGCCTGGGGG + Intronic
955867362 3:63399245-63399267 ATTTTGTTGTAGCAGCCAGAAGG - Intronic
960611497 3:119558881-119558903 GTGTCCTGGTAGCAGCCTGAAGG - Intronic
961117090 3:124339688-124339710 AATGTCTTGTAGATGCCTGATGG + Intronic
965635050 3:170772352-170772374 AGTTCTTTGTAGCAGTCTGGGGG + Intronic
970822723 4:20237689-20237711 TGTTCCTTGTAGAAGACTGAGGG - Intergenic
975054787 4:69916441-69916463 ATTTTGTTATAGCAGCCTGAAGG + Intergenic
975931809 4:79533630-79533652 AATTCCCTTTAGCACCATGAAGG + Intergenic
977732130 4:100366386-100366408 TATTCATAGTAGCAGCTTGAGGG - Intergenic
980136193 4:128861008-128861030 ACTTCCTTGAAGCAGCACGAAGG - Intronic
983361053 4:166723809-166723831 AATTCCATATAGCAGCATGTTGG - Intergenic
984492805 4:180457047-180457069 AATTCCTTGGAACGTCCTGAGGG + Intergenic
985159291 4:187027480-187027502 ACTTCCTTGGTGCAGCCTGAGGG + Intergenic
988106766 5:26760530-26760552 ATTTTGTTATAGCAGCCTGAAGG + Intergenic
988197026 5:28016675-28016697 AAATCCTGCTAGCAGGCTGAGGG + Intergenic
988529828 5:32017711-32017733 AATTCCCTGTAGCTGCTTGCAGG - Intronic
988739827 5:34059380-34059402 AGTTTGTTATAGCAGCCTGAAGG - Intronic
989975482 5:50581326-50581348 AAGTCCTGGTTGAAGCCTGAAGG - Intergenic
991653107 5:68876203-68876225 ATTTTGTTGTAGCAGCCTGAAGG + Intergenic
992018136 5:72596006-72596028 AATTACTTGTGGGATCCTGAGGG - Intergenic
992744357 5:79804744-79804766 AATTCCATGGAGGTGCCTGAAGG + Intergenic
993194627 5:84724981-84725003 ATTTCCTTCTAGCTGCATGAAGG + Intergenic
996563725 5:124857800-124857822 ATTTCCATATAGCAGCCAGAGGG - Intergenic
996670063 5:126107280-126107302 ATTTTATTGTAGCAGCCTGAAGG + Intergenic
999398831 5:151248957-151248979 AATTCATTCTAGCAACCTGTTGG - Intronic
1000532099 5:162435913-162435935 AATTTCTTTTACCAGCTTGAAGG - Intergenic
1001446810 5:171791618-171791640 AATTCCTTGAAGCAGATTGTTGG - Intronic
1001463996 5:171946138-171946160 ATTTCCCTGTTGCAGCCTGGAGG - Intronic
1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG + Intronic
1003917575 6:10801632-10801654 GATTCCTTGTTGCAACCTCAGGG + Intronic
1004070373 6:12291991-12292013 AGTTCCTTGTAGAAGCCAGCCGG + Intronic
1006395900 6:33787786-33787808 CATTGCTTGTAGCACCCTCATGG - Intronic
1013070844 6:106727884-106727906 AATTCCTTGCATCTGCCAGATGG - Intergenic
1014781944 6:125574720-125574742 AATTCCTCATTTCAGCCTGAAGG + Intergenic
1019772228 7:2890914-2890936 GATTCCTTATAGCAGCCACAGGG - Intergenic
1022665448 7:32406195-32406217 AATTCCCAGAAGGAGCCTGATGG - Intergenic
1022703703 7:32784257-32784279 AATTCCTTGTAGCAGCCTGATGG - Intergenic
1022907943 7:34874382-34874404 AATTCCTTGTAGCAGCCTGATGG - Intronic
1024136529 7:46414630-46414652 TATTCTTTTCAGCAGCCTGAAGG + Intergenic
1024977087 7:55123583-55123605 AATTGCTGGCAGCAGCTTGAGGG + Intronic
1026614468 7:71889119-71889141 ATTTTGTTGTAGCAGCCAGAAGG - Intronic
1029266307 7:99343865-99343887 AATGCCATGTAGCAGACTGTTGG + Intronic
1035003685 7:155638782-155638804 ATTTCATTACAGCAGCCTGAAGG - Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1038012660 8:23487216-23487238 ATTGCCTTGTAGTTGCCTGAAGG + Intergenic
1042159538 8:65878212-65878234 AATTTCTTTTAGCAGCCTTTGGG - Intergenic
1042755791 8:72209119-72209141 ATTTCCTTGTATCATGCTGAAGG + Intergenic
1044847475 8:96396329-96396351 AATTTATCATAGCAGCCTGATGG + Intergenic
1045632056 8:104135910-104135932 AAAGCCTTGTAGCAGCCTTGTGG + Intronic
1046983271 8:120360216-120360238 ATTGCCTTGTAGCACCCAGAAGG + Intronic
1051259965 9:15253593-15253615 AAATTAATGTAGCAGCCTGACGG + Intronic
1051424340 9:16918506-16918528 AATACCTTGTAGTATCCTTAGGG - Intergenic
1055478698 9:76688769-76688791 ACTTCCTTGTTGCAGCCTCAGGG + Intronic
1057126625 9:92620894-92620916 ATTTCGTGATAGCAGCCTGAAGG - Intronic
1058102884 9:100936959-100936981 AATTCCATCTACCAGCCTGCAGG - Intergenic
1059832230 9:118110061-118110083 TCTTCCTTGAAGCTGCCTGAAGG - Intergenic
1186808636 X:13165012-13165034 AATTCCTTTTAGTACTCTGAAGG + Intergenic
1187271913 X:17787710-17787732 AATGCCATGTAGCATCATGATGG - Intergenic
1194047358 X:89024683-89024705 ATTTTGTTATAGCAGCCTGAAGG - Intergenic
1194428399 X:93769115-93769137 AAATCCTTAAAGCAGCCAGAGGG - Intergenic
1201993592 Y:20057414-20057436 AATTCCTTCTGGCAGGCTCATGG + Intergenic
1201993758 Y:20059665-20059687 AATTCCTTCTGGCAGGCTCATGG + Intergenic
1201995592 Y:20084520-20084542 AATTCCTTCTGGCAGGCTCATGG + Intergenic
1203336234 Y_KI270740v1_random:3480-3502 AATTCCTTCTGGCAGGCTCATGG + Intergenic
1203336399 Y_KI270740v1_random:5731-5753 AATTCCTTCTGGCAGGCTCATGG + Intergenic
1203336623 Y_KI270740v1_random:8732-8754 AATTCCTTCTGGCAGGCTCATGG + Intergenic
1203336790 Y_KI270740v1_random:11107-11129 AATTCCTTCTGGCAGGCTCATGG + Intergenic