ID: 1022704816

View in Genome Browser
Species Human (GRCh38)
Location 7:32792407-32792429
Sequence TGTTCACTGCTGAAGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022704813_1022704816 -3 Left 1022704813 7:32792387-32792409 CCAAAACAGGATTGTCTGGGTGT No data
Right 1022704816 7:32792407-32792429 TGTTCACTGCTGAAGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022704816 Original CRISPR TGTTCACTGCTGAAGCTGGG TGG Intergenic
No off target data available for this crispr