ID: 1022705759

View in Genome Browser
Species Human (GRCh38)
Location 7:32800836-32800858
Sequence CAGGCCCACCAGCAGTTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022705754_1022705759 9 Left 1022705754 7:32800804-32800826 CCTCCACCTCTTGTGGAGGGCCT 0: 178
1: 123
2: 43
3: 46
4: 138
Right 1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG No data
1022705755_1022705759 6 Left 1022705755 7:32800807-32800829 CCACCTCTTGTGGAGGGCCTGAC 0: 177
1: 128
2: 50
3: 45
4: 117
Right 1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG No data
1022705756_1022705759 3 Left 1022705756 7:32800810-32800832 CCTCTTGTGGAGGGCCTGACTGA 0: 8
1: 7
2: 10
3: 183
4: 229
Right 1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022705759 Original CRISPR CAGGCCCACCAGCAGTTATC TGG Intergenic
No off target data available for this crispr