ID: 1022710537

View in Genome Browser
Species Human (GRCh38)
Location 7:32845038-32845060
Sequence CCCTGGAGGCGGCCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022710529_1022710537 1 Left 1022710529 7:32845014-32845036 CCGCAGCTCCTAGGGATGCTCCT No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710517_1022710537 28 Left 1022710517 7:32844987-32845009 CCCCCAGTCCTGCCCCAGTGCCC No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710520_1022710537 25 Left 1022710520 7:32844990-32845012 CCAGTCCTGCCCCAGTGCCCAGA No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710521_1022710537 20 Left 1022710521 7:32844995-32845017 CCTGCCCCAGTGCCCAGAGCCGC No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710519_1022710537 26 Left 1022710519 7:32844989-32845011 CCCAGTCCTGCCCCAGTGCCCAG No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710531_1022710537 -7 Left 1022710531 7:32845022-32845044 CCTAGGGATGCTCCTTCCCTGGA No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710518_1022710537 27 Left 1022710518 7:32844988-32845010 CCCCAGTCCTGCCCCAGTGCCCA No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710524_1022710537 14 Left 1022710524 7:32845001-32845023 CCAGTGCCCAGAGCCGCAGCTCC No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710527_1022710537 8 Left 1022710527 7:32845007-32845029 CCCAGAGCCGCAGCTCCTAGGGA No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710516_1022710537 29 Left 1022710516 7:32844986-32845008 CCCCCCAGTCCTGCCCCAGTGCC No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710528_1022710537 7 Left 1022710528 7:32845008-32845030 CCAGAGCCGCAGCTCCTAGGGAT No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710522_1022710537 16 Left 1022710522 7:32844999-32845021 CCCCAGTGCCCAGAGCCGCAGCT No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data
1022710523_1022710537 15 Left 1022710523 7:32845000-32845022 CCCAGTGCCCAGAGCCGCAGCTC No data
Right 1022710537 7:32845038-32845060 CCCTGGAGGCGGCCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022710537 Original CRISPR CCCTGGAGGCGGCCCAGGAG AGG Intergenic
No off target data available for this crispr