ID: 1022717300

View in Genome Browser
Species Human (GRCh38)
Location 7:32910180-32910202
Sequence CAATAGCAGTACAAGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022717299_1022717300 -6 Left 1022717299 7:32910163-32910185 CCTTTTTAACACTTGTACAATAG No data
Right 1022717300 7:32910180-32910202 CAATAGCAGTACAAGTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022717300 Original CRISPR CAATAGCAGTACAAGTAGTG TGG Intergenic
No off target data available for this crispr