ID: 1022722458

View in Genome Browser
Species Human (GRCh38)
Location 7:32953499-32953521
Sequence CACTTGAACCCCAGGGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022722458_1022722463 8 Left 1022722458 7:32953499-32953521 CCTCCGTCCCTGGGGTTCAAGTG No data
Right 1022722463 7:32953530-32953552 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1022722458_1022722465 9 Left 1022722458 7:32953499-32953521 CCTCCGTCCCTGGGGTTCAAGTG No data
Right 1022722465 7:32953531-32953553 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022722458 Original CRISPR CACTTGAACCCCAGGGACGG AGG (reversed) Intergenic
No off target data available for this crispr