ID: 1022725221

View in Genome Browser
Species Human (GRCh38)
Location 7:32975210-32975232
Sequence TCATTTTGATGTACTTCTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 250}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022725217_1022725221 -7 Left 1022725217 7:32975194-32975216 CCCCCAATTCAGTGCTTCATTTT 0: 2
1: 0
2: 2
3: 20
4: 335
Right 1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG 0: 2
1: 0
2: 0
3: 25
4: 250
1022725215_1022725221 -5 Left 1022725215 7:32975192-32975214 CCCCCCCAATTCAGTGCTTCATT 0: 2
1: 0
2: 2
3: 12
4: 230
Right 1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG 0: 2
1: 0
2: 0
3: 25
4: 250
1022725220_1022725221 -10 Left 1022725220 7:32975197-32975219 CCAATTCAGTGCTTCATTTTGAT 0: 2
1: 0
2: 3
3: 23
4: 282
Right 1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG 0: 2
1: 0
2: 0
3: 25
4: 250
1022725216_1022725221 -6 Left 1022725216 7:32975193-32975215 CCCCCCAATTCAGTGCTTCATTT 0: 2
1: 0
2: 0
3: 32
4: 230
Right 1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG 0: 2
1: 0
2: 0
3: 25
4: 250
1022725219_1022725221 -9 Left 1022725219 7:32975196-32975218 CCCAATTCAGTGCTTCATTTTGA 0: 2
1: 0
2: 1
3: 32
4: 335
Right 1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG 0: 2
1: 0
2: 0
3: 25
4: 250
1022725218_1022725221 -8 Left 1022725218 7:32975195-32975217 CCCCAATTCAGTGCTTCATTTTG 0: 2
1: 0
2: 2
3: 28
4: 285
Right 1022725221 7:32975210-32975232 TCATTTTGATGTACTTCTGATGG 0: 2
1: 0
2: 0
3: 25
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022725221 Original CRISPR TCATTTTGATGTACTTCTGA TGG Exonic