ID: 1022726198

View in Genome Browser
Species Human (GRCh38)
Location 7:32984081-32984103
Sequence CTCATTATGGTTCCTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022726195_1022726198 7 Left 1022726195 7:32984051-32984073 CCTGTTATGTTGTTAAATACATT 0: 1
1: 1
2: 7
3: 35
4: 352
Right 1022726198 7:32984081-32984103 CTCATTATGGTTCCTGTCTTTGG 0: 1
1: 1
2: 0
3: 13
4: 166
1022726194_1022726198 22 Left 1022726194 7:32984036-32984058 CCATTTAACTGTAAACCTGTTAT 0: 1
1: 1
2: 1
3: 22
4: 209
Right 1022726198 7:32984081-32984103 CTCATTATGGTTCCTGTCTTTGG 0: 1
1: 1
2: 0
3: 13
4: 166
1022726193_1022726198 23 Left 1022726193 7:32984035-32984057 CCCATTTAACTGTAAACCTGTTA 0: 1
1: 1
2: 0
3: 18
4: 216
Right 1022726198 7:32984081-32984103 CTCATTATGGTTCCTGTCTTTGG 0: 1
1: 1
2: 0
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022726198 Original CRISPR CTCATTATGGTTCCTGTCTT TGG Intronic
901008313 1:6182503-6182525 ATCATTAAGGTTACTGTTTTAGG + Intronic
903734734 1:25522915-25522937 CTCACTATGGTTCATCTCTCTGG - Intergenic
905995462 1:42377430-42377452 TTCATTATGGTTCATTCCTTGGG - Intergenic
906859368 1:49342458-49342480 CTCATTTTGTTTTATGTCTTTGG + Intronic
908369842 1:63470713-63470735 ATCATTATGGTATTTGTCTTTGG + Intronic
911030057 1:93478191-93478213 CTCAGCATGGTTGATGTCTTTGG + Intronic
912260319 1:108105112-108105134 ATCTTTATGTTTCCTGTCTCAGG - Intergenic
915400333 1:155617248-155617270 CTCATGGAGGTTCCTGTCTGGGG + Intergenic
918569352 1:185970364-185970386 CTCATTATTGACCCTCTCTTGGG + Exonic
918943845 1:191034875-191034897 CTCCTTATAGTTACAGTCTTTGG - Intergenic
924432375 1:244007988-244008010 CACATAATGGTCCCTGACTTAGG + Intergenic
1063580508 10:7301998-7302020 CTCAATATGGTCCCAGTCATAGG + Intronic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1067046354 10:42987433-42987455 CTCCCTGTTGTTCCTGTCTTGGG + Intergenic
1068294452 10:55051889-55051911 CTCATTATGTTTCTGGCCTTGGG + Intronic
1068607770 10:59024906-59024928 CTCATTATAATTGCTGTCTGAGG - Intergenic
1069232365 10:66027555-66027577 CTCATAATTGTCCCTTTCTTAGG + Intronic
1069766949 10:70869416-70869438 CTCACTGAGGTGCCTGTCTTTGG + Intronic
1071960469 10:90804778-90804800 CTCTTTTTGGATCCTGTCTTGGG + Intronic
1073665118 10:105523062-105523084 CTCATTTTTCTTCCTGCCTTGGG - Intergenic
1076402424 10:130192783-130192805 CTCATTATCTTGTCTGTCTTAGG + Intergenic
1078347030 11:10559195-10559217 CTCATTAGGGTTGCTATCATTGG + Exonic
1078701649 11:13690353-13690375 CTCTTTATTGTTAATGTCTTGGG + Intronic
1079586949 11:22137563-22137585 CCTATTATGGTTCATCTCTTAGG - Intergenic
1079809333 11:24976194-24976216 CTCATTATTGTCACTGTATTTGG - Intronic
1082767474 11:57180905-57180927 CTCCTCTGGGTTCCTGTCTTGGG - Intergenic
1082792941 11:57359701-57359723 CTCCTTTTGGCTCCTCTCTTAGG + Intronic
1083560567 11:63670592-63670614 TTCACTATGTTTCATGTCTTCGG + Intronic
1087024466 11:93636256-93636278 CACCTTTTGGTTCCTGTCTGTGG + Intergenic
1087226565 11:95607341-95607363 CTCATTATGCCCCCTTTCTTTGG - Intergenic
1088666639 11:112100090-112100112 CTCTTTATGGTTCTTGGTTTAGG - Intronic
1090983367 11:131744058-131744080 CCTATTTTGCTTCCTGTCTTTGG + Intronic
1091029034 11:132167724-132167746 CTCATTGTGTTTCCTGTCATTGG - Intronic
1092973805 12:13724710-13724732 CTCAATATGGCTCCTATCATTGG + Intronic
1092997237 12:13961979-13962001 CTGATTCTGATTTCTGTCTTAGG - Intronic
1093116440 12:15217541-15217563 ATCTTTTTGGTTCCAGTCTTTGG + Exonic
1094535562 12:31319688-31319710 ATCATTTTGCTTTCTGTCTTTGG + Intronic
1094601472 12:31912580-31912602 CTCACTATGTTGCCTGTCTTTGG + Intergenic
1094689967 12:32758957-32758979 TTCTTTATTGCTCCTGTCTTTGG - Intergenic
1097949457 12:65411014-65411036 CTCATTTTGTTTAATGTCTTGGG + Intronic
1105986557 13:25572852-25572874 CTTCGTATGGTTCCTGACTTGGG + Intronic
1106798041 13:33227773-33227795 CTCCTTATGGTGCTTGTCCTAGG - Intronic
1108346770 13:49554029-49554051 ATCATTATGGCTGCTGACTTTGG - Intronic
1110843724 13:80170786-80170808 CTCATTATGCTTCCTGCTGTTGG + Intergenic
1111236429 13:85414656-85414678 CACATTTTGCTTCTTGTCTTTGG + Intergenic
1111541600 13:89674680-89674702 CTCATTATTTTACCTTTCTTTGG - Intergenic
1112648325 13:101361194-101361216 CTTATTATGGTTTCTATCATGGG + Intronic
1114030248 14:18572686-18572708 ATTATTATGATTGCTGTCTTAGG - Intergenic
1114852212 14:26394859-26394881 CTCACTGTGGTTTCTGCCTTCGG + Intergenic
1117170699 14:53092121-53092143 CTCTTTATGGTTTCTGGCTTTGG - Intronic
1118889047 14:69892134-69892156 ATTGTTATGGTTTCTGTCTTTGG + Intronic
1120634693 14:86937213-86937235 CTTATTTTGGTGCCTTTCTTTGG + Intergenic
1132949844 16:2555199-2555221 CTCATGAAGGCTGCTGTCTTTGG + Intronic
1132964504 16:2644968-2644990 CTCATGAAGGCTGCTGTCTTTGG - Intergenic
1133572043 16:7050608-7050630 AATATTATGGTTCCTATCTTGGG - Intronic
1134835142 16:17355004-17355026 CTCATTTGGTTCCCTGTCTTTGG - Intronic
1134848073 16:17457961-17457983 CTCATTAAGCATCCTTTCTTTGG - Intronic
1141917748 16:87111622-87111644 CTCAGACTGTTTCCTGTCTTTGG + Intronic
1144143069 17:12368775-12368797 CCAATTATGGTTCCTCTCTTGGG + Intergenic
1152288904 17:79427685-79427707 CTCATTGTGCTTCCTATCTCAGG - Intronic
1153386195 18:4499511-4499533 CTCAGTATGCCTTCTGTCTTTGG + Intergenic
1157323739 18:46654477-46654499 CCCATCATGGGCCCTGTCTTAGG + Intronic
1157781864 18:50446585-50446607 ATAGTTATGGCTCCTGTCTTGGG - Intergenic
1158534855 18:58298503-58298525 CTAATAATGGTTTCTGCCTTAGG + Intronic
1158580277 18:58674726-58674748 CACACTATAATTCCTGTCTTTGG - Intronic
1159047790 18:63385814-63385836 CCCACTTTGGTTCCTGTGTTGGG + Intergenic
1160201466 18:76799617-76799639 CTCATTATGGTGCCTAACTGTGG - Intronic
1166438432 19:42789359-42789381 CTCATTATGGATCCTGGCAGGGG + Intronic
1166467320 19:43044008-43044030 CTCATTATGGATCCTGGCAGGGG + Intronic
1168443456 19:56391783-56391805 CTCCTTCTGGTTCCTCTCTTGGG + Exonic
1168719532 19:58547309-58547331 CTCATTCTGCTTCCTGAGTTGGG + Intronic
926129717 2:10295168-10295190 CTGATGATGGTTCCTGTTCTGGG - Intergenic
926494379 2:13566725-13566747 CTCCCTATGGTGCCTGTCTGGGG - Intergenic
926703001 2:15816607-15816629 GCCATGATGGTTCCTGTTTTGGG - Intergenic
928895197 2:36253728-36253750 CACATTTTGGCTTCTGTCTTTGG + Intergenic
928896544 2:36271715-36271737 CTCATTTTGCTTCTTGACTTTGG - Intergenic
929371473 2:41228983-41229005 CTCATTTTGGTTCATTTCTGTGG - Intergenic
932277006 2:70459028-70459050 CTCATTATGGTACCTTTCCCCGG - Intronic
932476967 2:72012503-72012525 CTCTCTGTGGTTGCTGTCTTGGG + Intergenic
934310376 2:91857428-91857450 ATTATTATGATTGCTGTCTTAGG + Intergenic
935328335 2:101958522-101958544 TTCATTTTGCTCCCTGTCTTTGG + Intergenic
936102059 2:109590767-109590789 CTCTTCATGCTTCATGTCTTTGG - Intronic
936159435 2:110072496-110072518 CTCAATATGGTTTTTGTCTTTGG + Intergenic
936185226 2:110298836-110298858 CTCAATATGGTTTTTGTCTTTGG - Intergenic
937055971 2:118937106-118937128 CCCTTTATGGTTCCTGAATTGGG + Intergenic
940665594 2:156605279-156605301 CTTCTAATGGTTTCTGTCTTAGG + Intronic
941659997 2:168186509-168186531 CTCATTGTAGTTCCCATCTTAGG + Intronic
943401162 2:187412402-187412424 CTCATTATGGCATCTGACTTGGG + Intronic
945149382 2:206772463-206772485 CTCCTTATTATTCCTGTCTGGGG + Intronic
947941158 2:234056840-234056862 CTCATTATGTGTCCTATGTTAGG + Intronic
948443665 2:238015177-238015199 TTCTTTAGGGTTTCTGTCTTTGG - Intronic
1169771206 20:9202845-9202867 TTCAATATGGTACCTGTCTCAGG + Intronic
1171429743 20:25074925-25074947 CTCATTATGGGTGCAGTCTCAGG + Intronic
1174163733 20:48569971-48569993 CTCATTCTGTTTCCTATTTTGGG + Intergenic
1177853976 21:26381373-26381395 CTCACTGTGGGTCCTGTCTGTGG + Intergenic
1180454361 22:15499736-15499758 ATTATTATGATTGCTGTCTTAGG - Intergenic
1181496498 22:23290162-23290184 CTCATCATGATTTCTGTCTTGGG - Intronic
1182523940 22:30903787-30903809 CTCATTATGTTGCCTGTACTAGG - Intronic
1184402975 22:44284641-44284663 CTCAGTCTGGCTCCTGTCCTTGG + Intronic
949582068 3:5398518-5398540 CTCATTAGGGCCCCAGTCTTAGG + Intergenic
951307823 3:21087145-21087167 CTCATGATGCTTCCTGTGTGTGG - Intergenic
953485915 3:43295653-43295675 CTGTTTATGGTTCTTATCTTTGG + Intronic
954827631 3:53388882-53388904 CTCATTTTGTTCCCTTTCTTTGG - Intergenic
954966328 3:54614386-54614408 CTCACCATGTTTCCTGTCCTTGG + Intronic
958032302 3:88126653-88126675 CTCATTAAGTTTCCTGTGTAAGG - Intronic
959155384 3:102660548-102660570 CATATTATGCTTACTGTCTTGGG + Intergenic
960846374 3:122007765-122007787 CTAATTATGATTCGTGCCTTGGG + Intronic
964690987 3:159449471-159449493 TTCATTATTGTTAATGTCTTTGG - Intronic
966044832 3:175535190-175535212 CCTAATATGTTTCCTGTCTTAGG + Intronic
969300032 4:6292259-6292281 CACATCATGGTTTCTGTCCTGGG - Intronic
969334868 4:6501843-6501865 CTCCTTATGGGACCTGTCATAGG - Intronic
970280367 4:14448407-14448429 CTCAGTGTGGATCCTGGCTTGGG - Intergenic
973291216 4:48472549-48472571 CTCATTATGCTTCCTGAATCTGG + Intergenic
974019925 4:56683976-56683998 CTGATCATGGTTCCTCTCCTGGG + Intergenic
977648314 4:99439604-99439626 GTCCTTATGTTTCATGTCTTAGG - Intergenic
977811272 4:101358408-101358430 CTCAATATACTTCCTGTTTTAGG - Intergenic
981435795 4:144720633-144720655 CTCATTATGGTGCCTGTTTCTGG + Intronic
981485996 4:145286768-145286790 CTCATTGTGGTTCTTCCCTTTGG - Intergenic
983975246 4:173925927-173925949 CCCATGATTGTTCCTGTTTTGGG - Intergenic
984225155 4:177026050-177026072 CTCATTATAGTTTTAGTCTTTGG + Intergenic
984243656 4:177248399-177248421 CTCATTATAATGCCTATCTTGGG + Intronic
986007004 5:3676924-3676946 GTCCCTATAGTTCCTGTCTTCGG + Intergenic
986044532 5:4024509-4024531 CTCTTTAAGTTTCCTCTCTTTGG - Intergenic
986776430 5:11018235-11018257 TTGATTACGGTTGCTGTCTTAGG - Intronic
988165329 5:27581695-27581717 CTCATGAAGTTTCCTGTCTGTGG + Intergenic
988449681 5:31328771-31328793 CTCAGTATCGTTCATGTCTTTGG + Exonic
990994977 5:61723613-61723635 TTCTTTATGGTTCCTGTGCTTGG + Intronic
994957838 5:106557492-106557514 CTCATTATGGTTCAGATATTGGG - Intergenic
995059483 5:107797776-107797798 CTCCTTAAGGTCCCTGGCTTCGG - Intergenic
995082862 5:108074408-108074430 CTCTTTTTGGATCCTGTTTTGGG + Intronic
996826942 5:127693908-127693930 GTCATTCTGGTTCCTGGCTGTGG + Intergenic
999333871 5:150698344-150698366 CTAATTATGGTTCTTTTCCTGGG + Intronic
1000005757 5:157183197-157183219 ATTATTATTGTTCATGTCTTAGG + Intronic
1001856120 5:175012365-175012387 CTCTTCTTGGTTCCTCTCTTGGG + Intergenic
1002689521 5:181040683-181040705 CTCATTGCGGTTCCCTTCTTGGG + Intronic
1008620231 6:53264199-53264221 CTCATACTGGTTCCTGTATGTGG + Intergenic
1008651374 6:53566759-53566781 CTCTGTATGGGTCCTGTTTTCGG + Intronic
1009375463 6:62962780-62962802 CCCATTAAGTTTCCTGTATTTGG - Intergenic
1009916893 6:70006531-70006553 CTTATTATGGTTCTTTTCTATGG + Intronic
1011495972 6:87936952-87936974 CTCTTTTTGTTCCCTGTCTTGGG - Intergenic
1013251752 6:108341446-108341468 CACATTATGTTTGCAGTCTTTGG + Intronic
1013537753 6:111078557-111078579 AACATTTTGGTTCCTATCTTAGG - Intergenic
1014647152 6:123988304-123988326 CTTATTTTTGTTCATGTCTTTGG - Intronic
1021715594 7:23459259-23459281 CCAATTATGAATCCTGTCTTTGG - Intronic
1022726198 7:32984081-32984103 CTCATTATGGTTCCTGTCTTTGG + Intronic
1022797469 7:33743482-33743504 CTTATTCTGCTTCCTTTCTTGGG + Intergenic
1024132106 7:46363709-46363731 CTTTTTTTGGTTGCTGTCTTTGG - Intergenic
1025047396 7:55703580-55703602 CTCATTATGGTTCCTGGCTTTGG - Intergenic
1026616729 7:71911775-71911797 CACATTATTCTTCCTGCCTTTGG + Intronic
1027124790 7:75548762-75548784 CAAATTCTGGTTTCTGTCTTAGG + Intronic
1028727051 7:94099904-94099926 ATAATTATGGTTTCTGCCTTTGG - Intergenic
1030330958 7:108269930-108269952 CACAGTATGGTTACTGTCTAAGG - Intronic
1030921007 7:115387315-115387337 CTCATTATGGTGCCTGTGACAGG + Intergenic
1031036716 7:116795533-116795555 CTCAATACGGTTTCTGTTTTGGG - Intronic
1032689100 7:134265028-134265050 CTGATTAAAGTTCCTTTCTTGGG + Intergenic
1032886595 7:136146467-136146489 CTCAGTATGGTGTCTGTTTTAGG - Intergenic
1035090472 7:156305975-156305997 CTCCTGATGGTCCCTGACTTAGG + Intergenic
1035111449 7:156485755-156485777 CTCTGTTTGCTTCCTGTCTTTGG - Intergenic
1038220301 8:25600937-25600959 TGCATAATGGTTTCTGTCTTTGG - Intergenic
1038344227 8:26717523-26717545 CTCCTTATGGTTCTTATGTTTGG + Intergenic
1040427650 8:47304822-47304844 CTTTTAATGGTTCCTGTATTAGG + Intronic
1043222883 8:77688651-77688673 CTCATTATACCTTCTGTCTTTGG + Intergenic
1044492115 8:92831412-92831434 TTTATTATGGTTCCTGATTTGGG - Intergenic
1046211234 8:111080065-111080087 CTGATTATTGTTCCTGTGTCAGG + Intergenic
1047811800 8:128418491-128418513 TTCATAATGGATCCTCTCTTTGG + Intergenic
1048094941 8:131281907-131281929 CTCAATATGCTTCCTGAATTAGG + Intergenic
1051780678 9:20685000-20685022 CTCAGTGTGGTTCCTGAATTTGG + Intronic
1053887874 9:42658245-42658267 ATTATTATGATTGCTGTCTTAGG - Intergenic
1054226895 9:62465695-62465717 ATTATTATGATTGCTGTCTTAGG - Intergenic
1054756443 9:68963523-68963545 CTTAGAATGGTTCCTTTCTTAGG - Intronic
1057753358 9:97809974-97809996 ATAATTATGTTCCCTGTCTTGGG - Intergenic
1058444491 9:105042772-105042794 CTCTTTCTGGTTTCTGTCTATGG + Intergenic
1061127829 9:128688252-128688274 CTTTTTATGGTTCATGTCTTGGG + Intronic
1186385032 X:9101772-9101794 CTCATTATTCTTTCTTTCTTTGG - Intronic
1188503613 X:30856720-30856742 AACATTATGGGTCCTGTTTTAGG - Intronic
1192553529 X:72072012-72072034 CTCATTCTGGTGGCTGTGTTGGG - Intergenic
1194833333 X:98652402-98652424 AGCATTATGGTTCCTGCCTATGG + Intergenic
1195244579 X:102983827-102983849 CTGATTCTGGTTCCTGGCTTGGG + Intergenic
1198435157 X:136609874-136609896 CCCACTATGGTGGCTGTCTTGGG - Intergenic
1200691194 Y:6307185-6307207 CTCATTCTGCTTCCTGTCCCTGG + Intergenic
1201044078 Y:9867531-9867553 CTCATTCTGCTTCCTGTCCCTGG - Intergenic