ID: 1022729620

View in Genome Browser
Species Human (GRCh38)
Location 7:33010221-33010243
Sequence CTGTGGAACTGGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022729620_1022729630 13 Left 1022729620 7:33010221-33010243 CCCACTTCTCTCCAGTTCCACAG No data
Right 1022729630 7:33010257-33010279 AACCAACCATTATTTCTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022729620 Original CRISPR CTGTGGAACTGGAGAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr