ID: 1022731884

View in Genome Browser
Species Human (GRCh38)
Location 7:33034283-33034305
Sequence ACAGTTATTCAGACTGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022731884_1022731887 22 Left 1022731884 7:33034283-33034305 CCTTCAACAGTCTGAATAACTGT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1022731887 7:33034328-33034350 CCTCCACAAACACCTTCTAGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1022731884_1022731890 30 Left 1022731884 7:33034283-33034305 CCTTCAACAGTCTGAATAACTGT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1022731890 7:33034336-33034358 AACACCTTCTAGAGGGCTCTAGG 0: 1
1: 0
2: 1
3: 11
4: 117
1022731884_1022731888 23 Left 1022731884 7:33034283-33034305 CCTTCAACAGTCTGAATAACTGT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1022731888 7:33034329-33034351 CTCCACAAACACCTTCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022731884 Original CRISPR ACAGTTATTCAGACTGTTGA AGG (reversed) Intronic
910645148 1:89506357-89506379 AGGTTTATTCAGACTGTAGAAGG - Intergenic
910744584 1:90559462-90559484 GCAGTTACTCACACTTTTGAAGG - Intergenic
911066085 1:93789876-93789898 ACAGTCAGTCATACTGGTGAGGG + Intronic
911432295 1:97806604-97806626 ACTCTGATTCAGAATGTTGATGG - Intronic
916349391 1:163831767-163831789 ATAGTTATTCAAAATGGTGATGG - Intergenic
918618812 1:186578833-186578855 ACAGGTGTTAAGCCTGTTGAGGG + Intergenic
921622621 1:217342766-217342788 ACAGTTATAAAGGCTGTTCAAGG - Intergenic
921780397 1:219156069-219156091 ACATTTATTCTCACTTTTGATGG + Intergenic
1064298487 10:14100513-14100535 TCATTTATTCAGACTTTTAAGGG - Intronic
1065392048 10:25192711-25192733 ACAATTATTCAAATTTTTGAGGG + Intronic
1067543284 10:47173241-47173263 AAAGATATTCAGATTCTTGAGGG - Intergenic
1072039956 10:91597585-91597607 ACAGAGATACAGACTGTTAATGG - Intergenic
1073441639 10:103555813-103555835 ACAGTTAGTTAGACAGCTGAGGG + Intronic
1078918280 11:15801511-15801533 ACAGATATTCAGAGTGTTTAGGG + Intergenic
1081634064 11:44709100-44709122 GGAATTATTCAGACTGTGGAGGG + Intergenic
1081917610 11:46742975-46742997 AGAGTTTTTCTGACTGTGGAGGG + Intergenic
1084191439 11:67500765-67500787 ACAGTTAATGAAATTGTTGATGG + Intronic
1086944473 11:92831534-92831556 ACAGCTTTGCAGACTTTTGAAGG - Intronic
1088246746 11:107825860-107825882 ACAGTACTTCTGACTGTTGCTGG + Intronic
1091115716 11:133011309-133011331 ACAGTTATTCAGAATAGTGAGGG + Intronic
1094709753 12:32949830-32949852 ACATTTTTAAAGACTGTTGAAGG + Intergenic
1096885575 12:54715877-54715899 ACAGAGATACAGACTGTTGGAGG + Intergenic
1097579105 12:61431823-61431845 ACAGTTTTTCAGGCTGTACAGGG - Intergenic
1098614461 12:72506194-72506216 CCAGCTATTCAGAAAGTTGATGG + Intronic
1099071611 12:78051268-78051290 GAGGTTATTCAGAGTGTTGAAGG + Intronic
1103989492 12:124789175-124789197 ACAGTGATACAGTATGTTGACGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105677630 13:22690340-22690362 ACAGTTACTCAGACAAATGAGGG + Intergenic
1107266592 13:38562618-38562640 TCAGTAATTCTGACTGCTGATGG - Intergenic
1107981716 13:45740359-45740381 ACAGTTGTTCAGACTGAACAAGG - Intergenic
1107982613 13:45747989-45748011 ACAGTTAATCAGACAGTTTTTGG + Intergenic
1109258829 13:60119034-60119056 ACAGTGATTAAAACAGTTGATGG - Intronic
1109265931 13:60200499-60200521 ACAGTTATTAAAAGTGTTGTTGG + Intergenic
1109562384 13:64069040-64069062 AGAGTTACACAGAATGTTGAGGG - Intergenic
1113012890 13:105791085-105791107 ACAGTTTTTCAGTGTGTAGAAGG - Intergenic
1114813778 14:25931221-25931243 ACATTTATTTAGAATGCTGATGG + Intergenic
1115778930 14:36747936-36747958 ACAGGAATTGAGACTATTGAGGG + Intronic
1116184099 14:41574902-41574924 ACATTTATTCACACTCTTCATGG - Intergenic
1118089525 14:62457802-62457824 ACAGTTATTTCACCTGTTGAAGG + Intergenic
1121460717 14:94075185-94075207 AAAGTTATTTTGACTGTTGTAGG - Intronic
1125673034 15:41487036-41487058 AGAGTGACTCAGACTGTGGAGGG + Intergenic
1126834098 15:52641587-52641609 TCAGTCATTCAGCCAGTTGAAGG + Intronic
1128282806 15:66410559-66410581 GCAGGTATCCAGACTGCTGAAGG + Intronic
1129580151 15:76800281-76800303 ACATTTATTCTATCTGTTGATGG + Exonic
1129736536 15:77968863-77968885 ACTCTTCTTCAGAATGTTGAAGG + Intergenic
1130739407 15:86582385-86582407 AAAGTTATTTACACTGTTGGTGG + Intronic
1131606149 15:93904833-93904855 TCAGATATTCAGGTTGTTGATGG - Intergenic
1132422420 15:101683015-101683037 ACCTTTAGTCAGACTGATGAGGG - Intronic
1133552498 16:6870757-6870779 ACAGTTGTTTAGTTTGTTGAGGG - Intronic
1134004167 16:10806614-10806636 CCAGCTATTCAGGCGGTTGAGGG - Intronic
1135685836 16:24497743-24497765 ACAGTTCTGCAGGCTGTAGAGGG - Intergenic
1136072284 16:27794990-27795012 AGAGTTATGCAGGCTGCTGAAGG - Intronic
1138235772 16:55381205-55381227 AAAGTTATTCAGAAAGTGGATGG + Intergenic
1140069534 16:71637161-71637183 AATGATATTCGGACTGTTGAAGG - Intronic
1140121420 16:72086117-72086139 ACAGTAATACAGACTGGAGATGG + Exonic
1146909722 17:36641115-36641137 TCAGTTTTCCAGACTGGTGAAGG + Intergenic
1153277418 18:3381262-3381284 AAAGTTATACAGACTGCTGTAGG + Intergenic
1153378683 18:4411327-4411349 ACAGTTATTAAAACTTTTAATGG + Intronic
1156059239 18:33053367-33053389 ACAGTGATTCAAATAGTTGAGGG + Intronic
1157704173 18:49788617-49788639 TCAGTTATCCAGCCTGGTGAGGG + Intronic
1162000184 19:7739555-7739577 ACAGTTCCTCTGCCTGTTGAAGG + Intergenic
1164517327 19:28947651-28947673 TTAGTTGTTCACACTGTTGAGGG + Intergenic
1167837784 19:52088548-52088570 ACATTTATTTTGACTGTAGATGG - Intronic
927634143 2:24799721-24799743 GCAGCTCTTCAGACTGTTTACGG - Exonic
928995773 2:37289461-37289483 ACAGTTATTTGGAATCTTGAAGG + Exonic
938819318 2:134939007-134939029 CCAGTTCTTGAGTCTGTTGAAGG - Exonic
940904428 2:159156400-159156422 ACTTTTATTCAGACTGTAGTTGG + Intronic
941103911 2:161330759-161330781 ACAGGCATTCAGTCTGCTGAAGG - Intronic
943268104 2:185763441-185763463 ACATTTAAGCAGACTGTTCAAGG - Intronic
946887000 2:224231089-224231111 GCAGTTATTAACAATGTTGATGG - Intergenic
947849339 2:233272606-233272628 ACAGTGATGCTGACTGTTGATGG + Intronic
948186685 2:236026755-236026777 ACAGTAAGACAAACTGTTGAGGG + Intronic
1170620720 20:17993718-17993740 TCAGTTATTTATACTATTGAAGG + Intronic
1173697893 20:45036993-45037015 ACAGTTATACAGACAGTTAGTGG + Intronic
1174595318 20:51678975-51678997 CCAGTTATTCAGAACCTTGAAGG - Intronic
1177647693 21:23920430-23920452 ACAGTCATATACACTGTTGATGG + Intergenic
1179087250 21:38228607-38228629 AAAGTTATGCAGAGTGTTGTGGG - Intronic
1179201869 21:39231663-39231685 ACAGTTATTCAGATTGCTGGTGG - Intronic
951199959 3:19865201-19865223 ACAATTATTCACACTTGTGATGG - Intergenic
953828661 3:46276746-46276768 ACAGTTCTTCAGTCAGTAGAGGG + Intergenic
955640794 3:61081669-61081691 ACAGTGATACAGACAGATGAGGG - Intronic
962579757 3:136787622-136787644 ACAGCTACACAGACTGTTCAGGG - Intergenic
963399675 3:144782022-144782044 ACATATATTCAGACTGTTTAAGG + Intergenic
963874874 3:150463779-150463801 ACAGATTTTCAGATTGGTGATGG + Exonic
964308425 3:155365090-155365112 ACAGGTAATCAGAAGGTTGATGG + Intergenic
966597298 3:181736212-181736234 AAAGTCATTCAGCATGTTGAAGG + Intergenic
967006952 3:185393149-185393171 AGAGATATTCAGAATGTTAAAGG + Intronic
967166404 3:186783636-186783658 ACAGGTATGCAGTCTGTTGGCGG + Exonic
967565946 3:190972286-190972308 CCAGTCATTCTGACTCTTGATGG + Intergenic
967584856 3:191200300-191200322 AAAATTATTCAGAGTGTTTAAGG + Intronic
967990999 3:195130740-195130762 ACATTTGTTCAGATTCTTGAAGG - Intronic
970745081 4:19284492-19284514 ACAGTTTTTCAGACAGATAAGGG - Intergenic
972492694 4:39602713-39602735 ACATTAAATCAGACTCTTGAGGG - Intronic
973297061 4:48536064-48536086 ACAGATCTTCAGACTGAAGAAGG - Intronic
973679915 4:53306772-53306794 CAATTTATTCAGCCTGTTGAGGG + Intronic
977575723 4:98672245-98672267 AAAATTATTCAGACACTTGAAGG - Intergenic
979143493 4:117209480-117209502 ACAGTTATTCAAAGTGGTGGAGG + Intergenic
979145872 4:117247187-117247209 ACAGTTAATCAGAGGATTGATGG + Intergenic
979623045 4:122817169-122817191 ACAGTTACTCTCACTGTTGGTGG - Intergenic
980432922 4:132727460-132727482 ACAGTTATGGAGACTCTTTAAGG - Intergenic
982444847 4:155478340-155478362 ACAGGTCCTCAGACTGGTGACGG + Intergenic
982500354 4:156146954-156146976 ACCGGTATTGAGACTGTTGAAGG + Intergenic
983449110 4:167888917-167888939 ACAGTAATGGAGAGTGTTGATGG - Intergenic
983703266 4:170624759-170624781 ATAATTATTTAAACTGTTGATGG + Intergenic
984654661 4:182304908-182304930 ACAGTGATTCAGTCTGTCGAGGG + Intronic
985299151 4:188469333-188469355 ATAATTATTAAGACTGGTGAGGG + Intergenic
988183317 5:27826753-27826775 TCAGTCATTTAGACTGTTCAAGG + Intergenic
989986232 5:50701556-50701578 ATAGTTATTCAAACTGTAAATGG - Intronic
993513928 5:88805894-88805916 ACAGGTATTCATTCTGTAGATGG - Intronic
994782079 5:104103287-104103309 AGAGTTATGAAGACTGATGATGG - Intergenic
995874166 5:116773080-116773102 AGTGTTATTCAGACTCCTGATGG + Intergenic
995965283 5:117899084-117899106 AGAATTCTTCACACTGTTGATGG - Intergenic
998513656 5:142734285-142734307 ACAGTTATACAAACAGTTAAAGG - Intergenic
999915071 5:156249410-156249432 ACAGTAATTCACAGTTTTGATGG + Intronic
1000756845 5:165171969-165171991 ACAGTTTTTGAGACTGGTAAGGG + Intergenic
1001769718 5:174284486-174284508 AAATTTTATCAGACTGTTGATGG - Intergenic
1002988130 6:2211069-2211091 ACAGTTATGCAGGCTGTACAGGG - Intronic
1003037912 6:2661405-2661427 ACAGTTAGACAAACTGTTGGGGG - Intergenic
1003086776 6:3066653-3066675 ACAGTAATGCAGGATGTTGATGG - Intronic
1008821476 6:55636950-55636972 ACACTTATTTAGACTTTGGAGGG - Intergenic
1009334770 6:62473401-62473423 ACAGTTCTTCAGCATGTTGAGGG + Intergenic
1010891061 6:81311294-81311316 AAAATTATTCATTCTGTTGAGGG + Intergenic
1011904994 6:92353741-92353763 ACAATTATGGAAACTGTTGATGG + Intergenic
1011945164 6:92891092-92891114 AGAGTAATGCAGACTGTTGGTGG + Intergenic
1013259817 6:108430539-108430561 AGAGTTATTAAGCCTGTTCATGG - Intronic
1013422097 6:109976714-109976736 AAAGATATTCAGACTGTCCATGG - Intergenic
1013458654 6:110355844-110355866 ACAGTGATTCAGGCTGGAGATGG - Intronic
1019888941 7:3929850-3929872 ACAGTCATGCAGGCTGTTCATGG + Intronic
1022731884 7:33034283-33034305 ACAGTTATTCAGACTGTTGAAGG - Intronic
1023080372 7:36521086-36521108 ACCGTCATTCAGGCTCTTGAGGG + Intronic
1026230404 7:68478278-68478300 ACAGGTATCCAAAGTGTTGAAGG - Intergenic
1027418388 7:77996612-77996634 ACATTTACTGAGACTGTTGAAGG + Intergenic
1028428383 7:90717371-90717393 ACAGTTATCAAGCCTATTGATGG + Intronic
1028583035 7:92426092-92426114 ACAGTTAACCTGACTGTTGCTGG - Intergenic
1032326540 7:130934405-130934427 ACAGTCATGCAGACAGTTGATGG - Intergenic
1040976526 8:53199324-53199346 ACAGTTCTTCAGAATTTTTAAGG + Intergenic
1042621520 8:70711155-70711177 ACTGTTATACAAACTGTTGGTGG + Intronic
1045455379 8:102373477-102373499 ACAGGTATTCAGAATGTGGATGG - Intronic
1045605126 8:103764520-103764542 TCATTTTTTGAGACTGTTGATGG + Intronic
1045835770 8:106519810-106519832 ACATTTAATCAGACAGTTGTAGG + Intronic
1046734317 8:117760272-117760294 ACAGTTATTCAGACAAATGATGG + Intergenic
1046756857 8:117981271-117981293 ACAGTAATTCAGACAGTAGGAGG + Intronic
1049951092 9:644698-644720 ACAGTAATCCCGAGTGTTGAAGG - Intronic
1054850234 9:69839960-69839982 CCAGCTATTCAGAGGGTTGAGGG + Intronic
1054897469 9:70329845-70329867 ACAGTTCTTCAGGCTGTACAAGG + Intronic
1054987105 9:71274466-71274488 ACATTTATACAGACAGTTAAGGG + Intronic
1055287971 9:74750906-74750928 AGAGTTACTCAGTGTGTTGATGG + Intronic
1056998108 9:91483068-91483090 ACTGTTGAGCAGACTGTTGAGGG - Intergenic
1058256809 9:102776961-102776983 ACTGTTATTCAGAATGTTACTGG - Intergenic
1059530834 9:115034069-115034091 GCAGTCATTTAGACTGTTGGAGG - Intronic
1060539147 9:124417898-124417920 ACAGTCATTCAGGCTGTAAAAGG - Intergenic
1060688533 9:125634938-125634960 ACAGTAATCCACACTTTTGATGG + Intronic
1061534551 9:131239549-131239571 GCAGGTATTCAGACAGTTCAAGG + Intergenic
1185659091 X:1712487-1712509 ATATTTATTCAGAGTGTAGAAGG + Intergenic
1186248216 X:7637477-7637499 ACAGTCAGTCAGAATGTTGTGGG - Intergenic
1187565158 X:20442562-20442584 ACGGATAATCAAACTGTTGAGGG + Intergenic
1188738320 X:33745577-33745599 ACAGTTATTCAGCCCACTGATGG - Intergenic
1188957860 X:36454860-36454882 TCAGTGATTCATACTGTTAAAGG + Intergenic
1190360261 X:49642634-49642656 AGGGTTATTCAGGATGTTGACGG - Intergenic
1192601157 X:72465611-72465633 AGAGTTATTCAGGCCCTTGAGGG - Intronic
1194452342 X:94060066-94060088 CCTGTTATTCAGGCTCTTGAGGG + Intergenic
1194571219 X:95556365-95556387 ACATTCATTCAGTCTGTTGGGGG - Intergenic
1195433027 X:104810707-104810729 TCAGTTTTTCAGAATGTTGTAGG - Intronic
1195993769 X:110710560-110710582 AAAGTCATTCAGACAGTGGATGG - Intronic
1199692279 X:150317668-150317690 GGAGCTATACAGACTGTTGAAGG + Intergenic
1199707927 X:150446993-150447015 ACACTTTTTAAGAGTGTTGATGG - Intronic
1199822764 X:151465739-151465761 GCAGTTCTGCAGACTGTTGGGGG - Intergenic
1200838640 Y:7757425-7757447 ACAGTGGTTCTGACTGTTGGAGG + Intergenic
1201678994 Y:16621361-16621383 ACAGTTATTTACACTGTGGATGG - Intergenic