ID: 1022734395

View in Genome Browser
Species Human (GRCh38)
Location 7:33062640-33062662
Sequence CGCCACCAGGGCGCACACGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022734385_1022734395 23 Left 1022734385 7:33062594-33062616 CCGTCTTCCTCTTCAAGGTGAAT 0: 2
1: 0
2: 0
3: 30
4: 326
Right 1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG 0: 3
1: 0
2: 0
3: 13
4: 81
1022734381_1022734395 28 Left 1022734381 7:33062589-33062611 CCGCCCCGTCTTCCTCTTCAAGG 0: 2
1: 0
2: 1
3: 31
4: 250
Right 1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG 0: 3
1: 0
2: 0
3: 13
4: 81
1022734383_1022734395 25 Left 1022734383 7:33062592-33062614 CCCCGTCTTCCTCTTCAAGGTGA 0: 2
1: 0
2: 3
3: 20
4: 193
Right 1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG 0: 3
1: 0
2: 0
3: 13
4: 81
1022734384_1022734395 24 Left 1022734384 7:33062593-33062615 CCCGTCTTCCTCTTCAAGGTGAA 0: 2
1: 0
2: 2
3: 19
4: 224
Right 1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG 0: 3
1: 0
2: 0
3: 13
4: 81
1022734387_1022734395 -10 Left 1022734387 7:33062627-33062649 CCAGCACCACCCCCGCCACCAGG 0: 3
1: 0
2: 8
3: 156
4: 1043
Right 1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG 0: 3
1: 0
2: 0
3: 13
4: 81
1022734386_1022734395 16 Left 1022734386 7:33062601-33062623 CCTCTTCAAGGTGAATATGTACT 0: 2
1: 1
2: 2
3: 9
4: 124
Right 1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG 0: 3
1: 0
2: 0
3: 13
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022734395 Original CRISPR CGCCACCAGGGCGCACACGC TGG Exonic
905308113 1:37033014-37033036 CGCCACCAGGCCGGACACCTGGG - Intronic
921177574 1:212607973-212607995 CTCCACATGGACGCACACGCAGG - Intronic
924946114 1:248848004-248848026 CGCCACCAGCGCACACACACGGG + Exonic
1066464312 10:35639851-35639873 CCCCACCAAGACGCACAAGCTGG - Exonic
1077014685 11:394336-394358 CAGCGCCAGGGAGCACACGCCGG - Exonic
1077078163 11:710513-710535 CGCCCCCAGGGAGCACCCTCAGG + Intronic
1081329747 11:41788567-41788589 CGCAAGCAGGGCGCACAGCCCGG + Intergenic
1081925916 11:46828164-46828186 CTCCACCAGGGAGCAGACTCAGG + Intronic
1082808491 11:57464423-57464445 GGCCATCAGGGCTCACACTCTGG + Intronic
1084084943 11:66850702-66850724 GGCCACCAGGGCCCCCATGCTGG + Exonic
1090276359 11:125422510-125422532 TGCCAGCAGGGCACACACCCTGG - Intronic
1097262196 12:57726209-57726231 CGCCCCTAGGGGGCACAAGCGGG + Intronic
1103036955 12:117664452-117664474 TGCCACCAGGGCCCAAAAGCAGG + Intronic
1103565270 12:121812137-121812159 CGCCAGCAGGGGGCGCCCGCGGG - Intronic
1104637492 12:130447335-130447357 GGCCTCCAGGGCCCACACGCAGG - Intronic
1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG + Intronic
1108662554 13:52600138-52600160 CGCCGCCAGGGCGCCATCGCTGG - Intergenic
1118106672 14:62667712-62667734 CACCACCAGGGAGCAGACTCTGG - Intergenic
1120979923 14:90280359-90280381 TTCCACCAGGGAGGACACGCAGG - Intronic
1123706257 15:22953232-22953254 CACCGCCAGGGCCCCCACGCTGG - Intronic
1127961540 15:63894357-63894379 AGCCACCCGGGCGCCCAGGCCGG + Intergenic
1128067848 15:64775579-64775601 CGCCGCCGCGGCGCACTCGCCGG - Exonic
1132608173 16:802109-802131 CAGCACCAGGGGGCACAGGCAGG - Intergenic
1133054914 16:3141051-3141073 CGCCACCAAGGCGTGCACACGGG + Exonic
1134290897 16:12902256-12902278 CCCGACCCGGGCGCCCACGCCGG + Exonic
1136477958 16:30525118-30525140 CGCCACCAGCGCACTCACTCTGG - Exonic
1136564534 16:31062017-31062039 CGCCACCAGCGCGCCCATGAAGG - Exonic
1137285664 16:47014093-47014115 CGCCTCCAGAGCGCACCCCCTGG + Intergenic
1139597912 16:67968740-67968762 CGCCACCAGGGCCCCCGCTCTGG - Intronic
1140613799 16:76634945-76634967 CGCCACTGGGGCGCACAGGCGGG - Intronic
1141870178 16:86779863-86779885 CGGCGCCAGGGTGCACACCCTGG + Intergenic
1142238706 16:88935367-88935389 CACCACCAGGGTCCCCACGCAGG - Intronic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1147326408 17:39671796-39671818 CGCCACCTGGGCGGACAGCCAGG - Exonic
1148330993 17:46813954-46813976 CCCTACCAGGGCCCACACTCTGG - Intronic
1152108662 17:78344886-78344908 CACCAGCAGGGCTCAGACGCAGG - Intergenic
1152186011 17:78856625-78856647 CGCCTCCAGGGCTCCCAGGCTGG - Intronic
1152579963 17:81161517-81161539 TGCCTCCAGGGGGCACAGGCAGG + Intronic
1152617975 17:81346433-81346455 GGCGACCTGGGCGCACCCGCCGG - Intergenic
1152842002 17:82575911-82575933 CGCCACCCAAGCACACACGCTGG - Intronic
1152842011 17:82575952-82575974 CGCCACCCGAGCACACACGCTGG - Intronic
1152842021 17:82576001-82576023 CGCCACCCGAGCACACACGCTGG - Intronic
1152842039 17:82576081-82576103 CGCCACCCGAGCACACACGCTGG - Intronic
1152842048 17:82576122-82576144 CGCCACCCGAGCACACACGCTGG - Intronic
1152842057 17:82576163-82576185 CGCCACCCGAGCACACACGCTGG - Intronic
1152842066 17:82576204-82576226 CGCCACCCGAGCACACACGCTGG - Intronic
1152842075 17:82576245-82576267 CGCCACCCGAGCACACACGCTGG - Intronic
1152963714 18:96712-96734 CGCCAGCAGGGCGTCCACACCGG - Intergenic
1154999166 18:21669923-21669945 CGACACCAGGAAGCACCCGCGGG + Intronic
1157613802 18:48975559-48975581 CGCCACCCCGGCGCGCACGGAGG + Intergenic
1160858912 19:1229444-1229466 CGCCGCAAGGGCGCACGCGCGGG + Exonic
1163509496 19:17726613-17726635 CACCAGCAGGGCGCACACAGAGG - Exonic
1166226240 19:41397395-41397417 CGTAACCAGTGCGCACGCGCCGG + Exonic
1166748235 19:45152060-45152082 CGCCTCCAGGGCGCCCCCGTCGG - Exonic
1167306814 19:48714409-48714431 CGCGGCCAGGGAGCACCCGCGGG + Exonic
927714199 2:25341851-25341873 CGGCACCAGGGCGCGCAGCCGGG - Intronic
934121318 2:88842888-88842910 CCCCACCCTGGCACACACGCAGG - Intergenic
934716986 2:96550138-96550160 CGCCGCCAGGGGGCGCCCGCCGG + Intronic
937958448 2:127437189-127437211 CTCCCCCAGGGGGCACATGCTGG + Intronic
946196377 2:218034903-218034925 CGCCACCAGGGGGCACAGGGAGG - Intergenic
947916790 2:233837855-233837877 CTCCCCCAGGGAGCACAAGCTGG + Intronic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1175172004 20:57087188-57087210 CGTGACCAGGGAGCACACACGGG - Intergenic
1176018857 20:62952657-62952679 GGCCACCAGGGCGGGCAGGCGGG - Exonic
1179980432 21:44892949-44892971 CGCCCCCTGGGGGCAGACGCCGG - Intronic
1183095277 22:35548207-35548229 CGGAACCAGGGCTCACACCCAGG - Intronic
950408061 3:12816819-12816841 CGCCATCAAGGCGCTTACGCTGG + Exonic
952816523 3:37452213-37452235 CGCCACCGGGGCGCGGACGGCGG - Exonic
953177913 3:40568544-40568566 GGCCACCAGGGCTCACATTCAGG + Intronic
954316397 3:49803929-49803951 CGCCACCAGGGCGGGCGGGCAGG - Intronic
955365459 3:58306472-58306494 CGCGACCCGGGCGCATGCGCGGG + Intronic
961649538 3:128410540-128410562 CGCCACCAGGGCACAGATTCAGG + Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
969716766 4:8871677-8871699 CGGCTCCCGGGCGCACGCGCGGG + Exonic
973551305 4:52038330-52038352 CCCCGCCAGGGCGCAAGCGCAGG - Exonic
979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG + Intergenic
998508819 5:142694628-142694650 CGCCACCAGGGTGACCAAGCTGG - Intronic
999307304 5:150528038-150528060 CCACACCTGGGCGCAGACGCCGG + Exonic
1020275558 7:6622495-6622517 CGCCACCAGGCCACGCACACGGG + Exonic
1020281837 7:6653802-6653824 CGCCACCGGCGCACACACACCGG + Exonic
1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG + Exonic
1022741749 7:33129063-33129085 CGCCACCAGGGCGCACACGCTGG + Intergenic
1023966726 7:44966744-44966766 CGCCACCAGGTCGCATACCTGGG - Exonic
1025075805 7:55942140-55942162 TGGCACCAGGGCTCACCCGCAGG - Exonic
1033727012 7:144129714-144129736 CCCCACCAGGATGAACACGCAGG - Exonic
1033737001 7:144232220-144232242 CCCCACCAGGAAGAACACGCAGG + Exonic
1033746056 7:144318726-144318748 CCCCACCAGGAAGAACACGCAGG - Exonic
1035670275 8:1411849-1411871 CACCACCAGGGCCCACACGACGG - Intergenic
1047452402 8:124977133-124977155 CGCCACCAGCGGACACACACAGG + Exonic
1049338486 8:142099253-142099275 CGCCTCCAGGCCGCACACAGAGG + Intergenic
1056135745 9:83628183-83628205 TGCCAGCAGGGCGCCCACGGTGG - Exonic
1061087109 9:128405673-128405695 TGCCAGCAGGGCCCACACGGAGG - Intergenic
1062522039 9:136961952-136961974 AGCCACCAGGGCCCCCACACAGG + Intergenic
1062734387 9:138127014-138127036 CGCCAGCAGGGCGTCCACACCGG + Intergenic
1203759832 EBV:6487-6509 CGCCACCAGATGGCACACGTGGG + Intergenic
1197962737 X:132023611-132023633 CGCCTCCATGGCCCACTCGCCGG + Intergenic
1200135657 X:153873388-153873410 GGCAACAAGGGGGCACACGCTGG + Intronic