ID: 1022734531

View in Genome Browser
Species Human (GRCh38)
Location 7:33063279-33063301
Sequence GGATGGCGGAGGTGGCGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022734531_1022734538 -1 Left 1022734531 7:33063279-33063301 CCCATTCGCCACCTCCGCCATCC No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734531_1022734539 0 Left 1022734531 7:33063279-33063301 CCCATTCGCCACCTCCGCCATCC No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022734531 Original CRISPR GGATGGCGGAGGTGGCGAAT GGG (reversed) Intergenic