ID: 1022734533

View in Genome Browser
Species Human (GRCh38)
Location 7:33063287-33063309
Sequence AGAAAAAAGGATGGCGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022734533_1022734538 -9 Left 1022734533 7:33063287-33063309 CCACCTCCGCCATCCTTTTTTCT No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734533_1022734541 30 Left 1022734533 7:33063287-33063309 CCACCTCCGCCATCCTTTTTTCT No data
Right 1022734541 7:33063340-33063362 TCCTGCCTAGTGTCTTCCAAGGG No data
1022734533_1022734539 -8 Left 1022734533 7:33063287-33063309 CCACCTCCGCCATCCTTTTTTCT No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data
1022734533_1022734540 29 Left 1022734533 7:33063287-33063309 CCACCTCCGCCATCCTTTTTTCT No data
Right 1022734540 7:33063339-33063361 CTCCTGCCTAGTGTCTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022734533 Original CRISPR AGAAAAAAGGATGGCGGAGG TGG (reversed) Intergenic