ID: 1022734538

View in Genome Browser
Species Human (GRCh38)
Location 7:33063301-33063323
Sequence CTTTTTTCTGTGTGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022734530_1022734538 19 Left 1022734530 7:33063259-33063281 CCGCGGGGTTTCTGCTACATCCC No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734528_1022734538 28 Left 1022734528 7:33063250-33063272 CCGCCGCAGCCGCGGGGTTTCTG No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734533_1022734538 -9 Left 1022734533 7:33063287-33063309 CCACCTCCGCCATCCTTTTTTCT No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734532_1022734538 -2 Left 1022734532 7:33063280-33063302 CCATTCGCCACCTCCGCCATCCT No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734529_1022734538 25 Left 1022734529 7:33063253-33063275 CCGCAGCCGCGGGGTTTCTGCTA No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data
1022734531_1022734538 -1 Left 1022734531 7:33063279-33063301 CCCATTCGCCACCTCCGCCATCC No data
Right 1022734538 7:33063301-33063323 CTTTTTTCTGTGTGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022734538 Original CRISPR CTTTTTTCTGTGTGAGCAGA AGG Intergenic
No off target data available for this crispr