ID: 1022734539

View in Genome Browser
Species Human (GRCh38)
Location 7:33063302-33063324
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022734528_1022734539 29 Left 1022734528 7:33063250-33063272 CCGCCGCAGCCGCGGGGTTTCTG No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data
1022734530_1022734539 20 Left 1022734530 7:33063259-33063281 CCGCGGGGTTTCTGCTACATCCC No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data
1022734532_1022734539 -1 Left 1022734532 7:33063280-33063302 CCATTCGCCACCTCCGCCATCCT No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data
1022734533_1022734539 -8 Left 1022734533 7:33063287-33063309 CCACCTCCGCCATCCTTTTTTCT No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data
1022734529_1022734539 26 Left 1022734529 7:33063253-33063275 CCGCAGCCGCGGGGTTTCTGCTA No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data
1022734531_1022734539 0 Left 1022734531 7:33063279-33063301 CCCATTCGCCACCTCCGCCATCC No data
Right 1022734539 7:33063302-33063324 TTTTTTCTGTGTGAGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022734539 Original CRISPR TTTTTTCTGTGTGAGCAGAA GGG Intergenic