ID: 1022735437

View in Genome Browser
Species Human (GRCh38)
Location 7:33071347-33071369
Sequence ACATGGCCAGAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022735437_1022735445 27 Left 1022735437 7:33071347-33071369 CCCTGCTCCTTCTCTGGCCATGT No data
Right 1022735445 7:33071397-33071419 CCATGATTGTAAGTTTCCTGAGG 0: 5548
1: 8228
2: 6830
3: 4292
4: 3006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022735437 Original CRISPR ACATGGCCAGAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr