ID: 1022736487

View in Genome Browser
Species Human (GRCh38)
Location 7:33081017-33081039
Sequence ACATATAAGGCACAGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022736479_1022736487 17 Left 1022736479 7:33080977-33080999 CCTCAGGATAGTATATAAGGTTC No data
Right 1022736487 7:33081017-33081039 ACATATAAGGCACAGAGGGGTGG No data
1022736482_1022736487 -10 Left 1022736482 7:33081004-33081026 CCTTATATGGGACACATATAAGG No data
Right 1022736487 7:33081017-33081039 ACATATAAGGCACAGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022736487 Original CRISPR ACATATAAGGCACAGAGGGG TGG Intergenic
No off target data available for this crispr