ID: 1022737520

View in Genome Browser
Species Human (GRCh38)
Location 7:33089919-33089941
Sequence GTTTCTCACAGTTCTGGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022737520_1022737525 14 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737525 7:33089956-33089978 GATGGAGGCCAAGACTTATAAGG No data
1022737520_1022737528 27 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737528 7:33089969-33089991 ACTTATAAGGGAGACTACGAAGG No data
1022737520_1022737523 -4 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737523 7:33089938-33089960 AAACATTGATATTTAAAGGATGG No data
1022737520_1022737526 15 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737526 7:33089957-33089979 ATGGAGGCCAAGACTTATAAGGG No data
1022737520_1022737522 -8 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737522 7:33089934-33089956 TGAGAAACATTGATATTTAAAGG No data
1022737520_1022737524 -1 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737524 7:33089941-33089963 CATTGATATTTAAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022737520 Original CRISPR GTTTCTCACAGTTCTGGCCT AGG (reversed) Intergenic
No off target data available for this crispr