ID: 1022737526

View in Genome Browser
Species Human (GRCh38)
Location 7:33089957-33089979
Sequence ATGGAGGCCAAGACTTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022737520_1022737526 15 Left 1022737520 7:33089919-33089941 CCTAGGCCAGAACTGTGAGAAAC No data
Right 1022737526 7:33089957-33089979 ATGGAGGCCAAGACTTATAAGGG No data
1022737521_1022737526 9 Left 1022737521 7:33089925-33089947 CCAGAACTGTGAGAAACATTGAT No data
Right 1022737526 7:33089957-33089979 ATGGAGGCCAAGACTTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022737526 Original CRISPR ATGGAGGCCAAGACTTATAA GGG Intergenic
No off target data available for this crispr