ID: 1022739330

View in Genome Browser
Species Human (GRCh38)
Location 7:33106648-33106670
Sequence TTTAGGAATATACAGTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022739330 Original CRISPR TTTAGGAATATACAGTTGGT GGG Intronic
902086856 1:13869320-13869342 TTTGGGATGATACAGCTGGTTGG - Intergenic
902236318 1:15059745-15059767 TCTAGGAATGTCCAGGTGGTGGG + Intronic
905717333 1:40162971-40162993 TTGATGAACTTACAGTTGGTGGG + Intronic
906469253 1:46113890-46113912 TTAAGGATTATAAAGGTGGTAGG + Intronic
908080053 1:60567359-60567381 TTGAAGATTATACAGTTGATGGG - Intergenic
908225769 1:62054428-62054450 TTTCAGTATATTCAGTTGGTTGG + Intronic
910005308 1:82389393-82389415 ATTAGGAATCTCCAGTAGGTTGG - Intergenic
910223972 1:84917492-84917514 TTGAGAAATATACATTTGTTAGG - Intergenic
910536627 1:88305473-88305495 TTTAGGAAAATAAAGTAAGTGGG - Intergenic
911976649 1:104505806-104505828 TTTGGGAAAATACAGCTGGAAGG + Intergenic
916386167 1:164272952-164272974 TTTAGAAATAAACAATTTGTAGG + Intergenic
917442747 1:175081474-175081496 TCTAGGAAGATACAGATGGATGG + Intronic
918377474 1:183923575-183923597 TTTAGGACCACACAGCTGGTGGG - Intronic
918428447 1:184434491-184434513 TTTAGGAACTTAGATTTGGTTGG + Intronic
919247592 1:195008158-195008180 TTTTTTAATGTACAGTTGGTGGG + Intergenic
921014310 1:211173858-211173880 TTTCCAAATGTACAGTTGGTTGG - Intergenic
922329859 1:224564932-224564954 TTTAGGACCAGACAGATGGTGGG + Intronic
922992553 1:229927120-229927142 GATATGAATATACAGTTGGGAGG - Intergenic
924032442 1:239900023-239900045 CTCAGGAATAAACAGGTGGTGGG - Intronic
1066703992 10:38157681-38157703 TTTAAGAATATATAGATGCTGGG + Intergenic
1071283081 10:84120462-84120484 TAGAGGAAGATGCAGTTGGTGGG + Intergenic
1072905661 10:99450960-99450982 CTTAGGAAGATAAAGTTGCTGGG - Intergenic
1073899815 10:108206757-108206779 TTAAGGAATATCCAGATAGTTGG - Intergenic
1074381900 10:112988031-112988053 TTTAGGAATGTACAGTTTACTGG + Intronic
1074430926 10:113393903-113393925 TTTAAGAAGGTACAGGTGGTTGG + Intergenic
1074819868 10:117169776-117169798 TTTAGGAATGTGAAGTTTGTGGG - Intergenic
1076036894 10:127206438-127206460 TATAAGAATATACAGTAGGCCGG - Intronic
1080022901 11:27582061-27582083 TTTCCAAATGTACAGTTGGTTGG - Intergenic
1080190522 11:29540853-29540875 TTTAAGAATATACCTTTAGTGGG + Intergenic
1080250937 11:30232872-30232894 TCTTGGGATATACATTTGGTAGG + Intronic
1080526719 11:33129430-33129452 TATAAAAATATACAGATGGTGGG + Intronic
1080727620 11:34914136-34914158 TTTAGGAGTATACACTTGAATGG - Intronic
1081266071 11:41023296-41023318 TTCAGTCATATGCAGTTGGTAGG + Intronic
1083556761 11:63635668-63635690 TTTAGGAAAATGCAGTTGTATGG - Intronic
1086924688 11:92627497-92627519 TTTTGGAATTTATAGTTGGATGG + Intronic
1087903748 11:103671722-103671744 TTTAGAAAAATACAGTATGTTGG - Intergenic
1088138681 11:106589308-106589330 TTTATGGCTATACATTTGGTTGG - Intergenic
1088689709 11:112315317-112315339 TTTAGGCATTTACAGCTGGCAGG + Intergenic
1090768844 11:129901101-129901123 TTTATGAATATACTATTAGTTGG - Exonic
1090860138 11:130645748-130645770 TCTAGGATTTTACAGTTGGAGGG - Intergenic
1096128000 12:49134152-49134174 TATAAGAATTTGCAGTTGGTGGG + Intergenic
1096776020 12:53964773-53964795 TTTAGGAATAGCCATTTTGTAGG - Intergenic
1096933764 12:55245546-55245568 TTTGGGACTATACTGGTGGTTGG + Intergenic
1096986993 12:55766287-55766309 TTTAGGAGTATAGATTTGATAGG - Intronic
1098448041 12:70587802-70587824 ATTAAGAATAAACTGTTGGTTGG + Intronic
1099032712 12:77547473-77547495 TTCAGGCACATACATTTGGTGGG - Intergenic
1099692643 12:85978860-85978882 TGTGGGAATATACAGTTGGGTGG - Exonic
1101426904 12:104595518-104595540 GTTAGGAATTTAGAGTTGGAAGG + Intronic
1103120229 12:118373603-118373625 TTTAGAAATTTTCAGTTTGTAGG + Intergenic
1105521660 13:21136612-21136634 TTTATGAATATACTCTAGGTAGG + Intergenic
1107098930 13:36567143-36567165 TTAAGAAATATACTCTTGGTTGG - Intergenic
1109329882 13:60916349-60916371 TTTAAGAAAATAAGGTTGGTTGG - Intergenic
1109707477 13:66115552-66115574 TATAGGTATACTCAGTTGGTGGG + Intergenic
1110374417 13:74776194-74776216 TTTAGGAATTTCTAGTTGATAGG - Intergenic
1111206630 13:85019865-85019887 TATAGGAATATAGAGTTTGTTGG + Intergenic
1112127832 13:96488629-96488651 ATTAGGAAAATGCACTTGGTGGG + Intronic
1113142674 13:107172106-107172128 TTTAGGAAGAAACAGTAGCTTGG - Intronic
1114924799 14:27383386-27383408 TTTAGGAAGAAACAGTTTGGGGG - Intergenic
1115527872 14:34299625-34299647 TATAGGAAGATACAGTAGGCTGG + Intronic
1117219040 14:53582681-53582703 TTAATGAATATACAGTGAGTTGG - Intergenic
1117615413 14:57529169-57529191 CTAAGGACTATAGAGTTGGTTGG - Intergenic
1117793867 14:59370912-59370934 TTAAGGAATAGACAGGTGGAGGG + Exonic
1118046118 14:61973667-61973689 TTTTGGAATATAAAGTTTTTTGG - Intergenic
1119756486 14:77123710-77123732 TTTAGAGTTATACAGCTGGTGGG + Intronic
1120581078 14:86249904-86249926 TTTATGAATATCCAGATGTTTGG - Intergenic
1122189078 14:100025629-100025651 TTTAAAAATACACAGTTGGCGGG + Intronic
1123678683 15:22739719-22739741 TTTAGAAACAGGCAGTTGGTAGG + Intergenic
1124330888 15:28814000-28814022 TTTAGAAACAGGCAGTTGGTAGG + Intergenic
1125692410 15:41606957-41606979 TTTAGGAAATGACAGTTGGCTGG - Intergenic
1128783434 15:70377854-70377876 TGTATGCATGTACAGTTGGTGGG + Intergenic
1130235216 15:82126904-82126926 TTTAGGAATAAACAGTGGGAAGG - Intergenic
1130629462 15:85551530-85551552 GGTAGGAATTTAAAGTTGGTTGG + Intronic
1130677235 15:85963828-85963850 TTTAAGAAGATACAGATGGCTGG - Intergenic
1135208832 16:20506695-20506717 TATAAGAATATACTGTTGGTAGG + Intergenic
1139316962 16:66080904-66080926 CTTAAGTATATACAGTTGGTTGG + Intergenic
1140741284 16:77943696-77943718 TTTAGGAATACAGGGTGGGTCGG - Intronic
1146138359 17:30342989-30343011 TTTAAGGATATACAGCTAGTAGG + Intergenic
1155400807 18:25437177-25437199 TCTACAACTATACAGTTGGTGGG + Intergenic
1165527886 19:36371519-36371541 TCTAAAAATATACAGTTGGATGG + Intronic
1166023948 19:40062060-40062082 TTTATTAGTATACAGTTGGTAGG + Intergenic
925002343 2:415370-415392 TTTAGAAACATTCAGTTGGTGGG - Intergenic
925575587 2:5356874-5356896 TTTAGGTATATACAGCATGTTGG - Intergenic
925992883 2:9268050-9268072 TTTAGGGATATACACCTTGTTGG - Intronic
926745687 2:16155349-16155371 TTTAGGATTAGACAGTTTCTAGG + Intergenic
927205408 2:20606251-20606273 TTTCTAAATGTACAGTTGGTTGG + Intronic
927977538 2:27350429-27350451 TTGAGGGAAAAACAGTTGGTAGG + Intronic
928043441 2:27902405-27902427 TCTAGGAATATACCTTTGATGGG - Intronic
930841950 2:55856914-55856936 TTAAGGAATATACAGTTTATTGG - Intergenic
931564996 2:63606570-63606592 TTTAGAAATATACTATTTGTAGG - Intronic
931635266 2:64334979-64335001 TTTAAAACTATACAGTGGGTAGG - Intergenic
932565306 2:72902606-72902628 TTTTGAAATATACAGGTGGCTGG - Intergenic
933402710 2:81819361-81819383 TTGAGGAATATAGAGTAGGCAGG - Intergenic
935843083 2:107134666-107134688 TGTAGGAACATGCAGTTGGAAGG + Intergenic
939320650 2:140615840-140615862 TTAAGGAATTTACAGATAGTTGG - Intronic
939453651 2:142404377-142404399 ATTAGGTATACACTGTTGGTGGG + Intergenic
940203630 2:151178171-151178193 TTTATGACTTTACAGTTGGACGG - Intergenic
942683138 2:178500342-178500364 TTCTGGAAAATTCAGTTGGTGGG - Intronic
943048624 2:182889004-182889026 ATTACTAATATAAAGTTGGTTGG - Intergenic
943655626 2:190505543-190505565 TCTTGGAAGATACAGTTAGTGGG - Exonic
945687177 2:212985744-212985766 TTTAGGAGTATATAGGTCGTGGG - Intergenic
947887615 2:233586478-233586500 TGTATGTCTATACAGTTGGTTGG + Intergenic
947897027 2:233684658-233684680 TTAAGGAATATACATATGATAGG + Intronic
948926812 2:241104220-241104242 TTTAAAAATATGCAGTGGGTTGG + Intergenic
1168972269 20:1938853-1938875 TTTAGGAACACACAGAGGGTAGG + Exonic
1170262589 20:14427053-14427075 TTTAGCAGTATAAATTTGGTTGG + Intronic
1171383344 20:24750340-24750362 TTCAGGAATGTATAGTTGATGGG - Intergenic
1173410562 20:42805934-42805956 TTTTTGAATATACACTTGGAAGG + Intronic
1178129247 21:29552090-29552112 TGGAGAAATATACAGTTGATTGG + Intronic
1181531432 22:23519693-23519715 TGTCGGATTACACAGTTGGTTGG + Intergenic
1181807037 22:25381179-25381201 TATAGAAATATACAGGTGCTGGG + Intronic
1182651330 22:31853659-31853681 TGTAGGCATATACATTTAGTCGG + Intronic
1184219800 22:43092540-43092562 TTTGCAAATGTACAGTTGGTTGG - Intergenic
949601969 3:5609985-5610007 TTTATTGATATACAGTTGGTTGG - Intergenic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
949881076 3:8661304-8661326 TTAAGGAAAAGACAGTTGTTGGG - Intronic
950351105 3:12354136-12354158 TTTCTGAATATACAGTTGCCTGG - Intronic
950832185 3:15885824-15885846 TTAAGGAATACCCAGTTAGTTGG + Intergenic
951210197 3:19966088-19966110 TTTTTGAATATACAGTTGAGTGG + Intronic
951590562 3:24260180-24260202 TTTAGGAAAATACAGTTGTCAGG + Intronic
952489303 3:33851134-33851156 TTTAGAAACAGGCAGTTGGTAGG + Intronic
952622829 3:35367024-35367046 CTTATGAAAATAAAGTTGGTTGG - Intergenic
954606130 3:51911321-51911343 ATTATGAAAATACAGTTGATTGG - Intergenic
957673275 3:83333161-83333183 TTTAGAAATATAATGTTGGAAGG - Intergenic
958033091 3:88137517-88137539 TTTAGGAATTCACAGTTGGGGGG + Intronic
959040919 3:101422604-101422626 TTTATAAATAGACAGTTGGATGG - Intronic
959604919 3:108232249-108232271 TTGAAGCTTATACAGTTGGTAGG + Intergenic
959867662 3:111289773-111289795 TTTAGGATTCTGCAGTTGTTGGG + Intergenic
960208526 3:114932079-114932101 TTTAGGAATAAAGATCTGGTAGG + Intronic
963215203 3:142738760-142738782 TTTAGAAATATAGAATAGGTTGG + Intronic
963385378 3:144585907-144585929 TTTAGGAATATTGACTTGGAGGG + Intergenic
966291070 3:178360496-178360518 TTTAGGAATTTACATTTTGGAGG - Intergenic
966309907 3:178581892-178581914 AATAGGAATACACTGTTGGTAGG + Intronic
966458915 3:180152654-180152676 TTTAGGATTTTATAGTTTGTAGG + Intergenic
967447741 3:189586314-189586336 TTAAGGAATACACTGTTGGTGGG - Intergenic
972344079 4:38178012-38178034 TTTAGGAAAACACATTTTGTAGG + Intergenic
973288076 4:48441718-48441740 TTTAGGAATAATTAATTGGTCGG + Intergenic
973990584 4:56402942-56402964 TTTAGGTATAGAAAGTTGATGGG - Intronic
974163517 4:58170448-58170470 TAAAGGAATATACAATTGGGAGG - Intergenic
979072309 4:116223408-116223430 TTTAGCAATATACTATTTGTAGG - Intergenic
983085329 4:163436303-163436325 TTTTGGAATATACTGTGGTTTGG + Intergenic
983945327 4:173579807-173579829 TTTAGGATTATGAAGATGGTTGG + Intergenic
984630249 4:182053218-182053240 TATAGGAATTTGCAGTTGGAGGG + Intergenic
984738957 4:183140219-183140241 TTCAGGAATGTACAGTGGGGAGG + Intronic
985115575 4:186586668-186586690 TCTTGGAATTTACATTTGGTGGG - Intergenic
985200771 4:187483059-187483081 TTCTGGAATTTACAGTTGTTTGG + Intergenic
988253060 5:28785566-28785588 TTTAAGACTATACAGTTGTTTGG + Intergenic
990237002 5:53779249-53779271 TTTTGGAATATACAGGGGCTGGG + Intergenic
993027213 5:82660879-82660901 TTAAGGCACATACAGTTAGTGGG - Intergenic
993904970 5:93612479-93612501 TTAAAGAATATGCAGTTTGTGGG - Intergenic
994028232 5:95110041-95110063 TTTATAAATACCCAGTTGGTGGG + Intronic
998993244 5:147842237-147842259 TTTAGGAATATTGTTTTGGTGGG + Intergenic
999986054 5:157006580-157006602 TTTAGGAATCTCCAGTGAGTAGG + Intergenic
1001487961 5:172133297-172133319 TTAAGGAAAAAACAGTGGGTTGG + Intronic
1002336989 5:178486583-178486605 TTCAGGAAGAGACAGTTGGGTGG + Intronic
1004835901 6:19531404-19531426 TTAAGGAATATTCAGTTAGCTGG + Intergenic
1008124084 6:47649352-47649374 TTTAGGATTATGGAGTTGGTGGG + Intergenic
1008352930 6:50514924-50514946 CTTTGAAATATACAGTTGCTTGG - Intergenic
1008807205 6:55444184-55444206 AGTAGGAATATACAGTTAATTGG + Intronic
1008899132 6:56591419-56591441 TTAAGGAATGGACAGTTGGAAGG - Intronic
1009911467 6:69934813-69934835 AATAGGAATGTACAGTTGGAAGG + Intronic
1011518033 6:88173914-88173936 TGTTTGTATATACAGTTGGTTGG + Intergenic
1013405646 6:109840575-109840597 TGGAGGAATATACAGTAGGATGG + Intergenic
1014339482 6:120186600-120186622 TTTAAAAATATGCAGTTAGTAGG - Intergenic
1015482209 6:133724890-133724912 TTTAAGAATACACAGTTATTTGG + Intergenic
1016341121 6:143062040-143062062 TCCAAGACTATACAGTTGGTTGG + Intronic
1017550254 6:155498376-155498398 TTTAGGCTCATACAGTTTGTTGG + Intergenic
1018416243 6:163604540-163604562 TTTAGGAATATAAATTTGCTAGG + Intergenic
1019141894 6:169953301-169953323 ATTAGGAATACCCAGATGGTTGG + Intergenic
1020976142 7:15009240-15009262 TGTAGGGATATACTTTTGGTTGG + Intergenic
1021784474 7:24138308-24138330 TTTAGGAATAGAAAGTTACTGGG - Intergenic
1022739330 7:33106648-33106670 TTTAGGAATATACAGTTGGTGGG + Intronic
1023759614 7:43452486-43452508 TTTAACAATATTCAGTTGGTAGG - Intronic
1024162951 7:46697663-46697685 ATTAGGAATATACAGTTACAGGG + Intronic
1024849167 7:53690156-53690178 TTTAGGAAAATAGAATTGGCTGG + Intergenic
1026054052 7:66969711-66969733 TTTAAAAAAATAGAGTTGGTTGG + Intergenic
1028239091 7:88397701-88397723 CTTATGATTATACAGATGGTAGG - Intergenic
1029040810 7:97571725-97571747 TTTATGAATATACATATGTTTGG - Intergenic
1029315992 7:99714485-99714507 TTTAGAAATATACATATGATCGG - Intronic
1030280322 7:107767932-107767954 TTTAGGAAGAAACAATTGTTTGG + Intronic
1030885517 7:114931781-114931803 TTGAAGAATATACCGTTTGTAGG + Intronic
1031106969 7:117555926-117555948 TTTTTGACTATACAGTGGGTTGG + Intronic
1032092477 7:128917916-128917938 TTGAGGAATATTCACCTGGTGGG + Intergenic
1033003370 7:137532591-137532613 TTCATCAATCTACAGTTGGTGGG + Intronic
1033273232 7:139951069-139951091 CTCTGGAATATTCAGTTGGTTGG - Intronic
1033951372 7:146788582-146788604 TTTGGGAATATAAATGTGGTGGG - Intronic
1035430363 7:158815519-158815541 TTTAGCAAGATACATTTGGCAGG - Intronic
1036283827 8:7425820-7425842 TTTAGAAATATACTTTTGCTGGG + Intergenic
1036337648 8:7885710-7885732 TTTAGAAATATACTTTTGCTGGG - Intergenic
1037135032 8:15450387-15450409 TTTAAAAGTATACAGTTGGCTGG + Intronic
1037238968 8:16755570-16755592 TTTAAGAAAACACAGCTGGTAGG - Intergenic
1037356471 8:18025208-18025230 TTTAGAAATATGCAGTTCATAGG - Intronic
1038098429 8:24342851-24342873 TTCTGGGATATACAGTTGTTTGG + Intronic
1038940919 8:32304411-32304433 TTTTGAAATATTCAGTTTGTGGG + Intronic
1040130518 8:43790531-43790553 TTTCGTTATATCCAGTTGGTTGG + Intergenic
1041537668 8:58945019-58945041 TTAAGGAATAAAAAGATGGTGGG + Intronic
1043676345 8:82960437-82960459 TTTAGGAATACACAGATGAATGG + Intergenic
1044034902 8:87289160-87289182 TTTAAGAATGTACAGTGGATAGG + Intronic
1046277471 8:111982441-111982463 TGGAGGAACATACAGGTGGTTGG - Intergenic
1047681192 8:127255969-127255991 TTTAAAAATATAAAGTAGGTGGG - Intergenic
1052827315 9:33186491-33186513 TTCAGGAATATCCAGTTGTGTGG - Intergenic
1052890523 9:33695202-33695224 TTTAGGAATGTTGATTTGGTAGG + Intergenic
1053158386 9:35795975-35795997 TTTTGGAGTTTACATTTGGTAGG + Intronic
1053210910 9:36227169-36227191 TTTAAGTATATATAGTTGGAAGG - Intronic
1055197355 9:73612538-73612560 ATTTGGACTAAACAGTTGGTAGG + Intergenic
1058217911 9:102257891-102257913 TGTATTAATATACTGTTGGTGGG - Intergenic
1058706475 9:107641615-107641637 TTCATGAATATACGTTTGGTGGG - Intergenic
1059782236 9:117542069-117542091 ATTAGGAATATAAAGTGGATTGG - Intergenic
1060654153 9:125357280-125357302 ATTAAGAATGAACAGTTGGTCGG + Intronic
1190396132 X:49987171-49987193 TTTAGGAATATAAGGTGGGATGG - Intronic
1190443586 X:50500406-50500428 TTTTGGAATACATAGTTGGGTGG - Intergenic
1192288365 X:69763349-69763371 TACAGGAACATACATTTGGTGGG + Intronic
1195473325 X:105258181-105258203 TTTAGGAAGCTTCATTTGGTTGG + Intronic
1195581527 X:106509407-106509429 TTTAGGAAGAATCAGGTGGTAGG - Intergenic
1196070801 X:111519341-111519363 TATAGGAAAAGACAGCTGGTTGG + Intergenic
1196106804 X:111905375-111905397 TTTAGGGATTTTCTGTTGGTTGG - Intronic
1196356489 X:114800339-114800361 TTTAGAAAAATACATTTTGTGGG + Intronic
1197197506 X:123718027-123718049 TTTTGTAATATACAGTTGGCTGG - Intronic
1201287218 Y:12389510-12389532 TTTTGAAATATACAATTGGCTGG + Intergenic
1201366916 Y:13216970-13216992 TTTATGACTATAAAGTTGATGGG + Intergenic
1201475344 Y:14375693-14375715 TATAGGAATATACAGGTTGGAGG + Intergenic
1201596131 Y:15671445-15671467 TTTACACATTTACAGTTGGTGGG - Intergenic