ID: 1022741407

View in Genome Browser
Species Human (GRCh38)
Location 7:33125145-33125167
Sequence TAAATAGTAGATACGATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022741406_1022741407 -5 Left 1022741406 7:33125127-33125149 CCTGAAGTTATATTATGTTAAAT No data
Right 1022741407 7:33125145-33125167 TAAATAGTAGATACGATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022741407 Original CRISPR TAAATAGTAGATACGATGTC TGG Intergenic
No off target data available for this crispr