ID: 1022743783

View in Genome Browser
Species Human (GRCh38)
Location 7:33149010-33149032
Sequence AGATTTGCAATGTATGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022743777_1022743783 20 Left 1022743777 7:33148967-33148989 CCATGACAAGAGTGGATGTGTGG 0: 1
1: 0
2: 0
3: 23
4: 132
Right 1022743783 7:33149010-33149032 AGATTTGCAATGTATGAATGGGG 0: 1
1: 0
2: 1
3: 16
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022743783 Original CRISPR AGATTTGCAATGTATGAATG GGG Intronic
902902642 1:19530222-19530244 AGGATTTCAATGTATGAATTTGG - Intergenic
904107364 1:28097186-28097208 AGATTTGTAAGGTAGAAATGAGG + Intergenic
908462661 1:64360640-64360662 AGTTTTCCAGTCTATGAATGTGG - Intergenic
908478229 1:64509973-64509995 AAATGTGAAATGTATGTATGTGG - Intronic
909483513 1:76150402-76150424 AGATGTGAAATCCATGAATGGGG + Intronic
910301275 1:85709484-85709506 AACATTGCATTGTATGAATGTGG + Intergenic
910850215 1:91642453-91642475 AGATTTGCAAGGTGCTAATGGGG + Intergenic
910969772 1:92844496-92844518 GGTTTTTTAATGTATGAATGAGG - Intronic
911104871 1:94121736-94121758 TGACTTGCAATGTCTGACTGGGG + Intergenic
911216841 1:95203943-95203965 AGAATTTCAATATATGAATTTGG - Intronic
911516075 1:98869699-98869721 TGTTTTTCATTGTATGAATGAGG - Intergenic
915826077 1:159078436-159078458 AGATGTGAAGTGTATGAATTTGG + Intronic
916191798 1:162186521-162186543 AGAGTTTCAACGTATGAATTTGG - Intronic
916349946 1:163837751-163837773 ATATTTGCACTTTATAAATGTGG + Intergenic
916834421 1:168528919-168528941 ATATTTGTAATATATTAATGGGG - Intergenic
917417885 1:174830246-174830268 AAATTTTCCATGCATGAATGTGG - Intronic
917698843 1:177559449-177559471 AGATTTGCATTTTTGGAATGTGG - Intergenic
919485879 1:198146581-198146603 AGATTTGGAATGTATGCAATTGG - Intergenic
920892730 1:210008229-210008251 AAATTTGCAAAGTTTTAATGTGG - Intronic
921106866 1:211989921-211989943 AAATGTTCAAAGTATGAATGAGG - Intronic
923961273 1:239086200-239086222 ATATTTGCAACCTATGAAAGAGG - Intergenic
924895561 1:248334641-248334663 AGAATTTCAACATATGAATGGGG + Intergenic
1063131113 10:3178172-3178194 AGAGGTGCAAGGTATGACTGAGG + Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1064742718 10:18449818-18449840 AGAGTGGCACTGTATGATTGAGG + Intronic
1066345542 10:34581677-34581699 AGATTTGCAGTGTAGGAGTCAGG - Intronic
1066641605 10:37559670-37559692 AGGTTTTCAATATATGAATTGGG + Intergenic
1067280790 10:44870597-44870619 AAATTTTCAATATATGAATTTGG + Intergenic
1069308121 10:66997909-66997931 AGATTTGCAATATATTCAGGAGG - Intronic
1073867114 10:107817858-107817880 ACATCTCCAATTTATGAATGAGG - Intergenic
1075026629 10:118989585-118989607 AGTTTTCCAATCCATGAATGTGG - Intergenic
1076435205 10:130436096-130436118 AAGTTTGCAATCTATGAATTTGG + Intergenic
1077684441 11:4277879-4277901 AGATTTTAAAATTATGAATGGGG - Intergenic
1077685598 11:4288889-4288911 AGATTTTAAAATTATGAATGGGG + Intergenic
1077690751 11:4340049-4340071 AGATTTTAAAATTATGAATGGGG + Intergenic
1077764807 11:5146483-5146505 AGATTTCCAATCCATGAATATGG + Intergenic
1079476391 11:20834189-20834211 AGATTTGGAATGGATAAATGTGG + Intronic
1079777086 11:24545186-24545208 ATATTTGCAAAGTATGCATCTGG - Intronic
1080270567 11:30447064-30447086 AGATTTGCACTCTATGAACTGGG + Intronic
1080721336 11:34852000-34852022 AAATTTGCAAACTATGCATGTGG + Intergenic
1080750029 11:35142660-35142682 AGATGTCCAATGTGTAAATGGGG - Intronic
1080902050 11:36503762-36503784 AGATTTGGAAGGTATAAAGGGGG - Intronic
1080979237 11:37380391-37380413 GGAAATGTAATGTATGAATGTGG - Intergenic
1081296531 11:41396926-41396948 ATTTTTGCAAACTATGAATGTGG + Intronic
1081625114 11:44650380-44650402 AGTTTTGTCATGAATGAATGTGG - Intergenic
1081739973 11:45432092-45432114 AGACTAGCAATGTATGTATGAGG + Intergenic
1082887835 11:58107082-58107104 AGTTTTCCAATTAATGAATGTGG + Intronic
1084377451 11:68787526-68787548 AGGATTTCAATATATGAATGGGG - Intronic
1084488931 11:69467666-69467688 AAACTTGCAATGTATGAATAAGG + Intergenic
1087264408 11:96044581-96044603 ATATTTGGAATGAATGCATGAGG + Intronic
1088890115 11:114037618-114037640 ACATTTGCAAGTTAAGAATGGGG - Intergenic
1089890659 11:121877538-121877560 ACATTTTCACTTTATGAATGGGG - Intergenic
1093121970 12:15281542-15281564 AGGTTTGAAATGTATGATTTTGG - Intronic
1093786139 12:23193948-23193970 AGAGTTCCAATGGATGAATAGGG - Intergenic
1095549695 12:43419810-43419832 AGATTTGAAATGTATGACCTGGG - Intronic
1096772069 12:53941463-53941485 AGCTGTTCTATGTATGAATGTGG + Intronic
1098114897 12:67164723-67164745 AGATTTGCAATGTTTCCTTGAGG - Intergenic
1099170407 12:79357194-79357216 AGATTTGCATTTTTTGCATGTGG - Intronic
1099561130 12:84174728-84174750 AGATTTGCAATGCATTCCTGTGG - Intergenic
1100285995 12:93167283-93167305 AGATCTGCAATGTGTTGATGAGG - Intergenic
1101240671 12:102835063-102835085 ACATTTGCAAGGTAAGATTGTGG + Intergenic
1101241317 12:102842537-102842559 ACATTTGCAAGGTAAGATTGTGG - Intronic
1101414853 12:104499962-104499984 AGCTTTGCAGTGTTTGATTGTGG + Intronic
1104471120 12:129030365-129030387 AGGTTTTCAATGAATGACTGTGG - Intergenic
1105397689 13:20055221-20055243 AAATTTGAAATCCATGAATGAGG - Intronic
1105988914 13:25598465-25598487 ATATTTGCATTCTATGAACGTGG + Intronic
1107263359 13:38521234-38521256 ATATTTGGAATAAATGAATGAGG + Intergenic
1108557072 13:51604000-51604022 ATGTTTGCCATGTAGGAATGCGG + Intronic
1108823764 13:54386948-54386970 AGAACTTCAACGTATGAATGTGG - Intergenic
1108834116 13:54519466-54519488 AGAATAGCCATGTATGAAGGAGG + Intergenic
1109213923 13:59565952-59565974 AGAATTGCAATATATGAGTTTGG + Intergenic
1109511442 13:63379794-63379816 AGTCTTCCAATTTATGAATGTGG + Intergenic
1109585916 13:64403691-64403713 ATATTTGCAAAGTATGTATCTGG - Intergenic
1110973208 13:81794037-81794059 AAATATGCAATGTATGCATAAGG + Intergenic
1111048127 13:82843111-82843133 AAATTTGCTATGTATGTAGGAGG + Intergenic
1111058685 13:82983369-82983391 AGAATTTCAAAGTATGAATTGGG - Intergenic
1112030568 13:95452935-95452957 ATATTTGCAATGTTTGAGTTGGG - Intronic
1115169968 14:30493516-30493538 TGCATTGCAATGTATGAATTTGG - Intergenic
1115421163 14:33197703-33197725 AGATTTGGAATGACTGAATAAGG - Intronic
1116715907 14:48426953-48426975 ATATTTGATATGTATGCATGAGG - Intergenic
1117466861 14:56002414-56002436 AGATTTGCAATTTATGAGCATGG + Intergenic
1118692121 14:68350078-68350100 AGATTTCCAATGTAAACATGTGG - Intronic
1118802633 14:69205124-69205146 AGATTTGGAATGTATGAAGGGGG - Intronic
1120130816 14:80805243-80805265 AGATTTGGAATGTGGAAATGAGG + Intronic
1120676973 14:87431889-87431911 AGGGTTTCAATGTATGAATTTGG - Intergenic
1121884258 14:97528565-97528587 AGATTTGCAACTTATGAACAGGG + Intergenic
1123141150 14:106080140-106080162 AAATTTGCAATGTTTTAATGAGG + Intergenic
1123979648 15:25589159-25589181 AGAAGTGCAGTGTATGGATGTGG - Intergenic
1123984749 15:25635479-25635501 AGAACTTCAATATATGAATGGGG + Intergenic
1124644827 15:31430997-31431019 AGAATTTCAACGTATGAATTGGG - Intronic
1125221791 15:37345810-37345832 AGCTTTGGAATGCATGAATTAGG + Intergenic
1125263791 15:37856079-37856101 AAATTTGGAATGCATGACTGTGG - Intergenic
1125275419 15:37984223-37984245 AGCTGTGCAAAGTGTGAATGAGG + Intergenic
1125845283 15:42846522-42846544 AGATGTGGAATGCATGGATGTGG + Intronic
1126303974 15:47233544-47233566 AGTCTTCCAATGTATGAATATGG + Intronic
1127059892 15:55171425-55171447 AGATTTGCCATGTGGGAAGGTGG - Intergenic
1130142657 15:81242350-81242372 AGTTTTTCAATCTATGAATATGG + Intronic
1130549646 15:84881783-84881805 AGAGTTTCAATGTCTGAATATGG + Intergenic
1131599460 15:93831649-93831671 AGAGTTTCAACGTATGAATTTGG + Intergenic
1132176356 15:99718500-99718522 AGAATTCCAATGAATAAATGTGG - Intronic
1134296279 16:12948757-12948779 AGAATTTCAATGTATGAAGCTGG + Intronic
1140446645 16:75034505-75034527 ATAAATGCAATGCATGAATGGGG - Intronic
1141396070 16:83705949-83705971 TGATTTGTTATGCATGAATGGGG - Intronic
1141874531 16:86813735-86813757 ATATTTGCAATGTATACACGTGG + Intergenic
1142755173 17:2012113-2012135 AGATCTGAAATGTCTAAATGAGG - Intronic
1143199605 17:5103157-5103179 AGATTTGGAAAGTATGAAAGGGG - Intergenic
1143295817 17:5871252-5871274 AGAGCTTCAATGTATGAATTTGG - Intronic
1144223902 17:13125852-13125874 ATATTTTCAATGTATAAATCAGG - Intergenic
1146129031 17:30254321-30254343 AGATTGGCAGTGACTGAATGAGG - Intronic
1147494070 17:40898982-40899004 AGATTTAAAATGTTTGAATCAGG - Intergenic
1150844836 17:68645262-68645284 AGAATTTCAATATATGAATTTGG - Intergenic
1155748067 18:29385930-29385952 AGTTCTGCAATGACTGAATGGGG - Intergenic
1156417063 18:36906932-36906954 AACTTTGCAATTCATGAATGTGG + Intronic
1157735047 18:50039988-50040010 AGGTTTGCAATCAGTGAATGTGG - Intronic
1157842318 18:50969897-50969919 AGAACTGCAATGTATGGATCAGG - Intronic
1157912376 18:51629169-51629191 AGGACTGGAATGTATGAATGTGG + Intergenic
1159076580 18:63688016-63688038 ATTTTTGCAATCTATGAATCAGG + Intronic
1159547474 18:69858032-69858054 AAATATGCAATGTATACATGCGG + Exonic
1161797765 19:6397063-6397085 TTATTTGCAATTCATGAATGGGG - Intergenic
1164812314 19:31166951-31166973 AGATCTGCCATCTATAAATGAGG - Intergenic
1166336161 19:42108973-42108995 ACATTTTCAATGAATGAATGAGG + Intronic
1167228480 19:48266078-48266100 ACAATAGCAATGTTTGAATGGGG + Intronic
1167801714 19:51747169-51747191 AGATTGCCAATGTATAGATGTGG - Intronic
926404149 2:12533013-12533035 ACATTTACAATGGATGAATGTGG - Intergenic
927450212 2:23202848-23202870 AGGGTTTCAATGTATGAATTGGG + Intergenic
928951631 2:36818272-36818294 AGATTACCAATATATAAATGTGG + Intergenic
931296672 2:60934015-60934037 AGTCTTCCAATCTATGAATGTGG + Intergenic
932373313 2:71211358-71211380 ATATCTGCAAAGTATGGATGTGG - Intronic
933692112 2:85186864-85186886 AGATTTGTACTGTACTAATGAGG + Intronic
934161271 2:89252028-89252050 AGTTTTATAATGCATGAATGTGG + Intergenic
934206008 2:89930387-89930409 AGTTTTATAATGCATGAATGTGG - Intergenic
935096615 2:99950665-99950687 AAATTTTCAATCTATGAATTTGG - Intronic
937415475 2:121711052-121711074 AGATTTTCATGGAATGAATGGGG + Intergenic
937587297 2:123568025-123568047 AGTTCTGCAATGGATGAAGGTGG - Intergenic
939189987 2:138904914-138904936 AATTTAGCATTGTATGAATGTGG - Intergenic
939514882 2:143153944-143153966 AGATTTGCAATTCATCTATGTGG + Intronic
940337281 2:152542763-152542785 AGCTTTTGAATGTATGTATGGGG - Exonic
940973288 2:159917126-159917148 AGATATACACTGTATGAATATGG + Intergenic
943941677 2:194006338-194006360 AGATTTTCAATGTCTGTATGAGG + Intergenic
943987939 2:194646852-194646874 AGGTTTGCAACATATGAATTTGG - Intergenic
944752130 2:202720670-202720692 CCAAGTGCAATGTATGAATGTGG - Intronic
945514480 2:210746328-210746350 AGATTTGCCATGTAGGAACTTGG - Intergenic
946999535 2:225437876-225437898 CTATATGCAATTTATGAATGGGG + Intronic
947225182 2:227832830-227832852 AGATTTGTAATGCAGAAATGAGG - Intergenic
947572040 2:231243819-231243841 AGATTTACAATGTGTGAAGAAGG + Intronic
947647553 2:231754935-231754957 AGGATTTCAATGTATGAATTTGG - Intronic
947885986 2:233572015-233572037 ATATTTGCAGTGCATGCATGTGG + Intergenic
948724529 2:239925081-239925103 AGTTTTCCAATTCATGAATGTGG - Intronic
1169903788 20:10580128-10580150 GTATTTGCAAGGTATGACTGAGG + Intronic
1173008854 20:39162918-39162940 AGTCTTTCAATGTATGAATATGG - Intergenic
1176189517 20:63801524-63801546 ACACTTTCAATGTATGAAAGGGG - Intronic
1177160198 21:17538978-17539000 GGATTTGGAATGTATTAAAGAGG + Intronic
1177210620 21:18066670-18066692 GGATTTCCAATATATGAATTTGG - Intronic
1177804094 21:25856820-25856842 AAATTAGCAAAGTATAAATGTGG - Intergenic
1182463115 22:30496078-30496100 AGATGTTCAATGTATTATTGGGG - Intronic
949178335 3:1094445-1094467 AGATTTCAAATATATAAATGTGG + Intronic
950330736 3:12154208-12154230 AGATCTGCACTGTATGAAGTTGG - Intronic
955677762 3:61466790-61466812 AGTTTTGCAGTGTATCAATCAGG - Intergenic
956302207 3:67784455-67784477 AGATCTCCAATTTATAAATGAGG + Intergenic
961585962 3:127925142-127925164 ACATCTTCAAAGTATGAATGTGG - Intronic
963944110 3:151126548-151126570 AGATATCCACTGTATGAGTGAGG + Intronic
964347893 3:155772816-155772838 ATTTTTGGTATGTATGAATGAGG - Intronic
965157293 3:165079896-165079918 AGTTTTGCAGTCTATGAATATGG - Intergenic
966294190 3:178399960-178399982 AGGATTTCAATGTATGAATTTGG - Intergenic
966350308 3:179026974-179026996 AGATTTTCAATGAATAAATTTGG - Intronic
966753073 3:183341097-183341119 AGAGTGGCAATGTCTCAATGAGG + Intronic
966957943 3:184903403-184903425 AATTTTCTAATGTATGAATGTGG + Intronic
967391372 3:188958991-188959013 AGGTATGAAATGTATGAACGGGG + Intronic
967899762 3:194437398-194437420 TGCTTTGCAACGTATGAGTGTGG - Exonic
969932983 4:10650782-10650804 AAATTTGCAATCTATGCATCTGG + Intronic
970356633 4:15260164-15260186 AGGATTTCAATGTATGAATTTGG - Intergenic
970637568 4:18025421-18025443 AGATTTGAAAAGTGTGCATGGGG - Intergenic
970803075 4:19999342-19999364 AAAATTACAATGTATGAAAGTGG + Intergenic
972108970 4:35530955-35530977 AGAATTTCAATATATGAATTTGG + Intergenic
972404983 4:38736888-38736910 AGAATTTCAATGTATCATTGGGG - Intergenic
973077337 4:45945863-45945885 AGAATTTCAATGTATAAATTAGG - Intergenic
973193972 4:47418632-47418654 ATCTTTGAAATGAATGAATGGGG - Intronic
973672139 4:53230789-53230811 AGATATGCAATATCTGAATCAGG + Intronic
974248565 4:59355679-59355701 AAATTTGCAAAATATGAATCTGG - Intergenic
977104346 4:92861827-92861849 ACATTTGCAATATTTCAATGAGG - Intronic
977589133 4:98807314-98807336 AGAATTTCAACATATGAATGGGG - Intergenic
980555907 4:134404219-134404241 AGTTTTGAAATGAAAGAATGTGG + Intergenic
981330445 4:143502337-143502359 AGAATTTCAATATATGAATTTGG + Intergenic
981495246 4:145383939-145383961 AGAGCTTCAATGTATGAATTTGG + Intergenic
981640627 4:146939620-146939642 ATATTTGCAGTATTTGAATGTGG + Intronic
981951368 4:150412052-150412074 ATATTTTGAATGAATGAATGAGG + Intronic
982675525 4:158371262-158371284 AGATTTGTTATTTATGAAAGTGG - Intronic
982944284 4:161599705-161599727 AGCTTTGCAATGTGTGTATATGG + Intronic
983268271 4:165530788-165530810 AGATTTTCAATGTATACATCTGG + Intergenic
984166224 4:176306133-176306155 AGAGCTTCAATGTATGAATTTGG - Intergenic
985039101 4:185870849-185870871 AAAGTTGAAATGAATGAATGTGG - Intronic
986514338 5:8545127-8545149 ATTTTTGCAATTTATGATTGCGG + Intergenic
986520282 5:8608730-8608752 AGGTCTTCAATATATGAATGGGG - Intergenic
986884423 5:12216169-12216191 ATACTTGCAATGTATTCATGAGG - Intergenic
990605701 5:57407744-57407766 AGAGCTGCAATATATGAATTGGG - Intergenic
991276467 5:64853416-64853438 AAATTTGCATTCTATGAAGGGGG - Intronic
992745877 5:79819841-79819863 AGATTTACAATTTATGCATAAGG - Intergenic
995320832 5:110831905-110831927 AGATTTGTAATGGATTAATAAGG - Intergenic
995764121 5:115597100-115597122 AGATTTTCAAAGTAAAAATGAGG - Intronic
999054781 5:148562717-148562739 AGATTTGCTATGTATTCATATGG - Intronic
1004472770 6:15943995-15944017 AAATTTGCACTGTATGAGTGAGG - Intergenic
1004873446 6:19931223-19931245 ATGTATGCAATGTATGTATGCGG - Intergenic
1006255020 6:32825672-32825694 AAATAAGCAATATATGAATGTGG - Intronic
1010880208 6:81158346-81158368 ATATTTGCAAACTATGCATGTGG + Intergenic
1011600602 6:89056594-89056616 AGAATTTCAACGTATGAATTTGG + Intergenic
1012194562 6:96324485-96324507 AGATTTGGAAGGTAAAAATGAGG + Intergenic
1012689092 6:102292077-102292099 AATTTTGCAATGCATGAATTTGG - Intergenic
1012971631 6:105737788-105737810 AGATTTGGAAGGCAGGAATGAGG - Intergenic
1014052355 6:116969418-116969440 TGATTTGCAGTTTATGAATCTGG - Intergenic
1014909579 6:127074992-127075014 AGAATTGCAATGAATCCATGAGG - Intergenic
1015798855 6:137040754-137040776 AGAATTCCAATGAATAAATGTGG + Intronic
1016758004 6:147708079-147708101 AGGATTTCAATGTATGAATTTGG - Intronic
1018072394 6:160176413-160176435 AGGGTTAAAATGTATGAATGTGG - Intronic
1018240587 6:161770387-161770409 AGAACTTCAATGTATGAATTTGG - Intronic
1020775502 7:12449649-12449671 TGATTCTCAATGTAAGAATGGGG + Intergenic
1021299374 7:18953511-18953533 AGATTTGCAAGGTAGGAGTTTGG + Intronic
1021448776 7:20761596-20761618 AGATTGGAAATGGAGGAATGAGG + Intronic
1022743783 7:33149010-33149032 AGATTTGCAATGTATGAATGGGG + Intronic
1024842962 7:53608937-53608959 AGAATTGCGATGTATTTATGTGG + Intergenic
1026714177 7:72772390-72772412 ATATTTCAAATGAATGAATGGGG + Intronic
1027793899 7:82668148-82668170 AGATTTTCAACATATGAATCTGG + Intergenic
1028014228 7:85686797-85686819 AAATTTGCAATCTATGCATGTGG + Intergenic
1029935657 7:104421801-104421823 AGCATTTCAATGTATGAATTTGG - Intronic
1030888226 7:114964898-114964920 AGAATAGCACTGTATGTATGTGG + Intronic
1031395086 7:121263926-121263948 AGAATGTCAATGTATGAATTTGG - Intronic
1031665248 7:124475541-124475563 AGATTTTAAAATTATGAATGGGG - Intergenic
1031680055 7:124661432-124661454 CCATTAGCAATGTATGAATGGGG + Intergenic
1036446834 8:8828988-8829010 AGATTTGCATTGTAGGAAGAAGG - Intronic
1037514426 8:19616593-19616615 AGATTTGCTATGAATGATTTAGG + Intronic
1037556976 8:20034310-20034332 AGATTTCCCATGGGTGAATGGGG + Intergenic
1038108515 8:24465981-24466003 AGCTTTGCAGTATATGAATAAGG + Intronic
1039450450 8:37670332-37670354 ATATTTGCAATATATGTATATGG + Intergenic
1040698008 8:50025793-50025815 AGAGTTACAATGTATCAATTAGG - Intronic
1040841375 8:51788791-51788813 AGATCTGCAATGTGAGAATGAGG - Intronic
1041182643 8:55264742-55264764 AGAATTGCAATGCATCAATATGG + Intronic
1042776175 8:72434150-72434172 AGATATGTAAGGTATGAAGGTGG + Intergenic
1042999795 8:74743863-74743885 AGGTTTGCAATCTATTAGTGTGG - Intronic
1043315115 8:78910694-78910716 AGATTTAAAATGTATGAACATGG - Intergenic
1043348497 8:79329374-79329396 ACATTTATAATGTATGAATGAGG + Intergenic
1045159417 8:99521399-99521421 TTATTTGAAATGTAGGAATGTGG + Intronic
1047239882 8:123077156-123077178 AGTTTTGCGATTTTTGAATGTGG + Exonic
1047833541 8:128662402-128662424 GGATTTTCAATGTATGCAGGTGG - Intergenic
1048769048 8:137875441-137875463 AGATTTGAAATGTAGAATTGAGG - Intergenic
1051118155 9:13721258-13721280 ATATTAGCTATGAATGAATGGGG + Intergenic
1051692629 9:19732574-19732596 ACATATGCAATGTCTTAATGAGG + Intronic
1051994349 9:23196699-23196721 ATGTTTGCAATGCTTGAATGTGG + Intergenic
1053095490 9:35323877-35323899 AAATTTTCAATGAATAAATGGGG - Intronic
1053314361 9:37038634-37038656 ACATTCGCAATATATGAATATGG + Intergenic
1055612109 9:78033051-78033073 TGATTTGCAATATGTGATTGAGG + Intergenic
1055942524 9:81663946-81663968 AGGTTTGCAATTTATAATTGAGG - Intronic
1056406947 9:86283529-86283551 AGATTCGCAGTGTTTGAATGTGG + Intergenic
1057235966 9:93360526-93360548 AGCCCTGTAATGTATGAATGTGG - Intergenic
1057699558 9:97353831-97353853 ACATTTGCATTGTAAGACTGAGG - Intronic
1058086913 9:100757543-100757565 AGATTTACAATGCAATAATGTGG + Intergenic
1058917515 9:109581856-109581878 AGATTTTCGATGTTTGAATTTGG + Intergenic
1059696633 9:116736026-116736048 AGCTTTTCAATGTCTGAATGGGG - Intronic
1185948629 X:4405369-4405391 AGGATAGAAATGTATGAATGTGG - Intergenic
1186025049 X:5300189-5300211 AGATTTTCATTTTATGAATTAGG + Intergenic
1186943175 X:14534937-14534959 TGATTAGCAATGTACCAATGAGG + Intronic
1187563061 X:20420429-20420451 ACATTCTCAATATATGAATGGGG - Intergenic
1190283832 X:48949040-48949062 AGTTTTCCAATCTGTGAATGGGG + Intronic
1192918475 X:75680504-75680526 AGAATTTCAATGTCTGAATTTGG - Intergenic
1193938790 X:87655058-87655080 ATATTTGCAAAGTATGTATGTGG - Intronic
1196666048 X:118317919-118317941 AGGGTTTCAATGTATGAATTTGG - Intergenic
1198681283 X:139185355-139185377 AGATTTGCAATAATTGCATGGGG - Intronic
1199754853 X:150854488-150854510 AGGATTTCAATGTATGAATTGGG - Intronic
1199814016 X:151381443-151381465 ACATTTGCAATGTCTGATTTTGG - Intergenic
1199821114 X:151447823-151447845 AGATTTGCAAGCTATGCATCTGG + Intergenic
1200366350 X:155669190-155669212 ACATTTGGAAAATATGAATGTGG - Intronic
1201352962 Y:13066552-13066574 AAATTTGCAATGTAAAAATATGG + Intergenic
1201735749 Y:17259343-17259365 AGGATAGAAATGTATGAATGTGG - Intergenic
1201966069 Y:19737380-19737402 ATATTTTCAATGTATAAGTGAGG + Intronic