ID: 1022746523

View in Genome Browser
Species Human (GRCh38)
Location 7:33178381-33178403
Sequence CTGAGTGGACACAATGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022746523_1022746529 8 Left 1022746523 7:33178381-33178403 CCACCTTCATTGTGTCCACTCAG 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1022746529 7:33178412-33178434 CTTCCAGATTCACCAAGGCTTGG No data
1022746523_1022746528 3 Left 1022746523 7:33178381-33178403 CCACCTTCATTGTGTCCACTCAG 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1022746528 7:33178407-33178429 CAGAGCTTCCAGATTCACCAAGG 0: 1
1: 0
2: 1
3: 22
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022746523 Original CRISPR CTGAGTGGACACAATGAAGG TGG (reversed) Intronic
900466023 1:2825887-2825909 CTGTGAGGACACAGAGAAGGCGG - Intergenic
903024760 1:20419416-20419438 CTGAGTGGTCACAGTGGAAGTGG + Intergenic
904302533 1:29563796-29563818 CTGTGTGGAGATTATGAAGGGGG + Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906573767 1:46868964-46868986 CTGAGAGGACACAAACAAGTGGG + Intergenic
916472402 1:165137220-165137242 CTGAGTGCCCAGAATGAGGGAGG + Intergenic
916480917 1:165213583-165213605 CTGAGTGCACACAGAGAAGTGGG + Intronic
916998373 1:170326959-170326981 TTAAGTGGAGACACTGAAGGAGG + Intergenic
917520051 1:175740792-175740814 CACAGAGGACTCAATGAAGGTGG + Intronic
919305032 1:195821381-195821403 CTGAGTGGTGCCAATGAAGTTGG - Intergenic
919484129 1:198126047-198126069 CTGAGAGTACAAAATGCAGGAGG + Intergenic
919632673 1:199974211-199974233 GTGAGTGGACAGAATTGAGGTGG + Intergenic
921034145 1:211360125-211360147 CTGAGTGGTCACAGTGAATCAGG + Intronic
921301153 1:213752825-213752847 CTAAGTGGACAGATTGGAGGTGG - Intergenic
1063293100 10:4771786-4771808 CTCAGTGGACACAGTTATGGGGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1067102174 10:43341668-43341690 GAAAGTGGAAACAATGAAGGTGG + Intergenic
1067286839 10:44913066-44913088 CTGAGTGGAGGCACTGAGGGAGG + Intronic
1067573702 10:47391330-47391352 TTGAATGGACACAATGAAAATGG + Intergenic
1069198114 10:65580128-65580150 CTGAGGGGACACAATGGACAGGG + Intergenic
1071058367 10:81538545-81538567 CTGAGTGAGCAAAATGATGGAGG - Intergenic
1071367694 10:84916667-84916689 CTCAGAGGACAGAAAGAAGGAGG - Intergenic
1071430857 10:85605596-85605618 TTGAGTGGACTCAATTAAAGTGG + Intronic
1074350562 10:112732906-112732928 CAGAGTTGACACAGTAAAGGTGG + Intronic
1078272833 11:9812395-9812417 CTGATGGCACACAATGAAGGAGG + Intronic
1081229342 11:40565155-40565177 CTGAGAGGAAACATTGAAGAAGG - Intronic
1083631932 11:64100102-64100124 CTCAGTCCACACAATGAAAGTGG + Intronic
1084495248 11:69499666-69499688 CTGAGTAGACAGAGTGAAAGGGG - Intergenic
1088568340 11:111196711-111196733 CTGAGTGGTCTCAATGAAGATGG - Intergenic
1088597331 11:111450204-111450226 CTGAAAGGACACAAGGGAGGTGG - Intronic
1091268935 11:134292192-134292214 CTGAGTGGCCACACCAAAGGAGG + Exonic
1091343546 11:134837977-134837999 CTGATTGGACCCACTGAAGAGGG - Intergenic
1094196331 12:27753498-27753520 CTGAGTGGGCACCAAGAAGCAGG - Intronic
1094356475 12:29583481-29583503 CACAGTGGACACAATCAGGGTGG + Exonic
1094439085 12:30454992-30455014 CACAGTGGACACAATCAGGGTGG - Intergenic
1095694715 12:45131662-45131684 CTGAGTAGAAACAGTGCAGGAGG + Intergenic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1097233192 12:57524291-57524313 CTGATTACACACAATGAATGGGG + Exonic
1098394052 12:69999580-69999602 CTGAGGGGGCACAGTGAAGCTGG + Intergenic
1098577545 12:72060310-72060332 CTGAGTGGAAGCAGTGAAGGTGG - Intronic
1099918428 12:88925952-88925974 TTGAGTGGAGACAGTGAAAGTGG - Intergenic
1101477084 12:105061157-105061179 CTGAGTGTACAAGATGAAGAGGG - Intronic
1103270332 12:119668213-119668235 CTGCGGGGACACAGGGAAGGCGG - Exonic
1105967127 13:25395249-25395271 CTAAGTGGACACATTGCAGATGG - Intronic
1106860827 13:33906323-33906345 GTCAGTGGACACAATGACTGGGG - Intronic
1107561596 13:41561892-41561914 CTGAGAGCACTCACTGAAGGCGG - Intergenic
1107651466 13:42549440-42549462 CTTTGTGGACACATTGAATGTGG + Intergenic
1107840186 13:44449700-44449722 CTGAGTGGGGCCAATGAAGTGGG + Intronic
1108114044 13:47108624-47108646 CTGTGTGGAAACAATGGATGAGG - Intergenic
1109159962 13:58958921-58958943 ATTAGTGAACAGAATGAAGGTGG - Intergenic
1121081108 14:91109080-91109102 CTGAAAAGACACAATGAATGCGG + Intronic
1122147755 14:99703348-99703370 GTGAGTGGATACATTGGAGGAGG - Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1123962814 15:25423928-25423950 CAGAGTGGTCACAGTGAGGGTGG - Intronic
1124139113 15:27061983-27062005 GTCAGTGGACAGAAGGAAGGAGG - Intronic
1124250064 15:28101245-28101267 CTGAGTGGCCACAGTAATGGAGG + Intergenic
1124686483 15:31787001-31787023 CTTAGTGGAGACACTGAAAGGGG + Intronic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1133645062 16:7756323-7756345 CTGAGGGGTCATAATGAAGATGG - Intergenic
1135735737 16:24930838-24930860 CTGAGTGGACACCAGGAGGTTGG + Exonic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137675762 16:50303160-50303182 CAGAGTTGTCACAATGGAGGAGG + Intronic
1137718626 16:50613974-50613996 CTGAGGGGAAACAAAAAAGGGGG - Intronic
1140657336 16:77154250-77154272 CAGAGTGGCCTCACTGAAGGTGG + Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141762982 16:86040738-86040760 CTGAGCCACCACAATGAAGGGGG - Intergenic
1141854780 16:86673618-86673640 ATGAATGGACAAAATGATGGAGG - Intergenic
1143486028 17:7254812-7254834 ATGAGGGGAAACAATGAAGGAGG - Intronic
1144228606 17:13176355-13176377 CTGAGTGGCCACAATGAGGGTGG - Intergenic
1148135825 17:45291002-45291024 CTTGCTGGACACAGTGAAGGAGG - Intronic
1151656903 17:75500397-75500419 CTGAGAGGACACAATGGGGGAGG - Exonic
1152747356 17:82047552-82047574 CTCAGTGGACACATTGAGAGTGG - Intergenic
1153180273 18:2425095-2425117 CTGACTTGTCATAATGAAGGTGG - Intergenic
1153220500 18:2856560-2856582 CTGCGTGTACATAATGAAGTAGG + Intronic
1153812713 18:8765894-8765916 CTGAGTGGACAGAAGGAAAGAGG - Intronic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1156417947 18:36918168-36918190 CTGATTGGATACAAAAAAGGGGG - Intronic
1156616402 18:38790541-38790563 TTGTGTGGACAAAATGAATGGGG - Intergenic
1157252080 18:46104008-46104030 CTGAGTGGATGCAATCAATGTGG + Intronic
1158400591 18:57118061-57118083 GTGAGTGGAGACAGAGAAGGAGG - Intergenic
1159093359 18:63873939-63873961 TTGAGAGGACAAAAAGAAGGGGG - Intronic
1162832163 19:13292136-13292158 CAGGGTGGACAAAATGAGGGTGG - Intronic
1164077231 19:21831142-21831164 CTGAATGGACACACAGAAGTTGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
926193543 2:10745984-10746006 CTGAGTGGATACATAGAATGTGG - Intronic
926641509 2:15243072-15243094 CTGAGTGGTGGCAGTGAAGGTGG - Intronic
932570537 2:72936173-72936195 CTGACTGGACACAAGTGAGGTGG - Intergenic
936931389 2:117793031-117793053 TTGCGTGGATACAATGAAGAGGG + Intergenic
937436367 2:121885072-121885094 CTGAGTTGAACCAATGGAGGAGG + Intergenic
937907965 2:127061572-127061594 CTGAGGGGAAACCATGAGGGAGG - Intronic
940251789 2:151685734-151685756 GTGAGTGGATACAATGAAGCTGG - Intronic
941490986 2:166142037-166142059 ATGAGTAGACACAAAGAGGGTGG + Intergenic
946531257 2:220572698-220572720 CTGGGCAGCCACAATGAAGGAGG - Intergenic
946548587 2:220775382-220775404 CCAAGAGGACACAATGAAGATGG + Intergenic
948465353 2:238149376-238149398 CAGAGGGCCCACAATGAAGGGGG + Intronic
1169118223 20:3081030-3081052 CTGAGTGGACAACATGAAACAGG + Intergenic
1169864102 20:10181615-10181637 CTGAGATGACCCAATGAAGATGG - Intergenic
1171143234 20:22760717-22760739 ATGGGTGGAAACCATGAAGGAGG - Intergenic
1171211101 20:23317498-23317520 AAGAGTGGAAACAATGAAGAAGG - Intergenic
1173627012 20:44480483-44480505 CTGAATGGACACACTGCAGAAGG - Intronic
1174887482 20:54351889-54351911 CTGGGTGGTCAAAATGATGGTGG - Intergenic
1175278804 20:57788896-57788918 TTGAGTGGACCCAGGGAAGGAGG + Intergenic
1178047028 21:28706965-28706987 CTTAATGTACACAAAGAAGGTGG + Intergenic
1178052997 21:28768361-28768383 CTGAGTGGACACTCTGCAAGTGG - Intergenic
1180693677 22:17738578-17738600 CTGAATGGACAGGAGGAAGGGGG + Intronic
1181570415 22:23765202-23765224 CTGGATGAACTCAATGAAGGCGG + Intronic
1182986330 22:34721428-34721450 CTGAGTCTTCACAAGGAAGGGGG + Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
949336193 3:2978252-2978274 TTGAGTGGAAACATTGAAGAGGG + Intronic
951063160 3:18234131-18234153 CTCAGTGGACACAAGGTAGTAGG + Intronic
957174236 3:76784942-76784964 AAGAGTGGACACATTGAAGAAGG - Intronic
957787749 3:84903926-84903948 CTGAGTAGACACAATGAGACTGG - Intergenic
957846572 3:85744593-85744615 ATGTTTGGACAGAATGAAGGTGG + Intronic
959811314 3:110622934-110622956 TTGGGTGGACACCATGCAGGTGG + Intergenic
961318237 3:126055115-126055137 CTGAGTGGCCATTAGGAAGGAGG + Intronic
964569490 3:158095793-158095815 CTGGGTGGATAAAATGGAGGGGG + Intergenic
970320489 4:14870881-14870903 GTGAGTAGACATAATGAATGTGG - Intergenic
972201144 4:36716030-36716052 CTGTGTGGATACCATGATGGTGG + Intergenic
972274646 4:37545711-37545733 CTGAGCTGAAACAATGAATGGGG - Intronic
974446702 4:61993589-61993611 CAGGGTAGAAACAATGAAGGAGG - Intronic
975691571 4:76969700-76969722 CTGAGTAAACACAACCAAGGAGG + Intronic
977351471 4:95894184-95894206 TTGAGGGGACAAAATGAAAGAGG + Intergenic
978454590 4:108874373-108874395 CTGAGTAGACAAAGTGACGGAGG + Intronic
982148971 4:152430997-152431019 CTGGGTGGATATATTGAAGGAGG - Intronic
986028443 5:3872518-3872540 AAATGTGGACACAATGAAGGGGG - Intergenic
986293816 5:6421232-6421254 GTGAGCAGACACAATGAAGAAGG - Intergenic
997508441 5:134436742-134436764 CTGAGAGCACAAAATGAAGTTGG + Intergenic
998681867 5:144476964-144476986 TTGAGTGGATACAATGAATGGGG + Exonic
1000458464 5:161482511-161482533 TTGAGTGGCCACAATAAAGAAGG - Intronic
1000475706 5:161704310-161704332 CTGGGAGGACACAATGAGGCTGG + Intergenic
1000999173 5:167989313-167989335 GTGAGTGCACAAAATGAAGGGGG + Intronic
1003674717 6:8192669-8192691 CTGAGTGGAGCCAAGGAAGGGGG + Intergenic
1006298903 6:33182928-33182950 CTGTTTGGTCAGAATGAAGGTGG - Intronic
1011090155 6:83588819-83588841 CAGAGAGGCCACAATGGAGGAGG + Intronic
1014563706 6:122922162-122922184 CTGAGTGCACACAATGAGTGAGG + Intergenic
1014662191 6:124186488-124186510 ATCAGGAGACACAATGAAGGAGG + Intronic
1016262121 6:142184718-142184740 CTGAGTGTCCACAATGTAGAGGG + Intronic
1016739747 6:147514325-147514347 CTGAGTGGAACCAGTGAGGGAGG + Intronic
1018995832 6:168709884-168709906 GAGAAAGGACACAATGAAGGAGG - Intergenic
1019046015 6:169146786-169146808 GTGTGTGGACACCAAGAAGGGGG - Intergenic
1019224474 6:170498780-170498802 ATGCGTGAACAGAATGAAGGGGG + Intergenic
1019503772 7:1380316-1380338 CTCGGGGGACACAATGCAGGAGG + Intergenic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1022746523 7:33178381-33178403 CTGAGTGGACACAATGAAGGTGG - Intronic
1023091880 7:36625091-36625113 CTTAGTGGACCTAATGAAGAGGG + Intronic
1023159266 7:37281855-37281877 CTGACTGCACACAATGTACGAGG + Intronic
1025069943 7:55889074-55889096 ATGAAAGGACACAATTAAGGGGG - Intronic
1026425423 7:70287561-70287583 GTGAGTGGACAAAAAGAAGGTGG - Intronic
1026458070 7:70590007-70590029 CTGAGTGGCCACAATGACTTAGG + Intronic
1026569830 7:71519788-71519810 CTGACTGGACACAAAAAGGGAGG - Intronic
1029282620 7:99446134-99446156 CTGACTGGACAGTGTGAAGGTGG - Intronic
1029362907 7:100100425-100100447 CTAAGGGGACCCAAAGAAGGCGG - Intronic
1031361183 7:120850510-120850532 CTGAGTGGAGTCAATGAGGGAGG + Intronic
1032936407 7:136737761-136737783 CTAAGTAGAAACAATGCAGGAGG - Intergenic
1034907032 7:154958305-154958327 CTGAGTTGAAACTATGAAGGAGG - Intronic
1035957686 8:4100381-4100403 CTGACTAGACACAGGGAAGGTGG - Intronic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039574277 8:38611124-38611146 CTGAGTGGACACAATCAGTCTGG + Intergenic
1039577175 8:38632910-38632932 CTGAGTGAACAGAATGGAGAAGG - Intergenic
1039686397 8:39806877-39806899 GAGACAGGACACAATGAAGGAGG + Intronic
1041258004 8:55995825-55995847 CCGAGTGGAAACAAAGAATGTGG - Intronic
1043263962 8:78238790-78238812 CTTAGAGTACACAATGAAGTAGG - Intergenic
1046049138 8:109000547-109000569 GTGAGTGGACACAATGTAACCGG - Intergenic
1051120119 9:13743690-13743712 CTGAGTTGTCACAAAGGAGGAGG - Intergenic
1052268601 9:26603222-26603244 CAGAGTGTACACAATGAAGTGGG - Intergenic
1054533057 9:66201462-66201484 TTAAGTGTACAAAATGAAGGTGG - Intergenic
1056914210 9:90730631-90730653 CTGAGTGGGGACAGGGAAGGGGG - Intergenic
1057074908 9:92133507-92133529 CTGAATGGGCTGAATGAAGGAGG + Intergenic
1060127179 9:121059450-121059472 CTCAGTGGAACCAAAGAAGGTGG - Intergenic
1060421026 9:123469596-123469618 CTAAGGAGACACAATGAAGGTGG + Intronic
1060858235 9:126933103-126933125 GTGAGAGGACAAAAGGAAGGCGG + Intronic
1061195079 9:129103094-129103116 CTGCGTGGACACCCTGAGGGAGG + Intronic
1062035972 9:134382684-134382706 CTGAGTGGGCAGTATGAGGGTGG + Intronic
1062397398 9:136357991-136358013 CTGGGTGGACACAGTGCAGTTGG - Intronic
1186123647 X:6389188-6389210 CTGAGGGGACAGAATGAAATGGG - Intergenic
1187551977 X:20315303-20315325 CAGAGTGGAGACAAAGAAAGGGG + Intergenic
1188064273 X:25638504-25638526 CTGAGCAGAAACAATGAAGCTGG + Intergenic
1190381073 X:49840243-49840265 CTGAGTGGAGACACTAAATGTGG - Intergenic
1192669493 X:73125071-73125093 CTGAGTGGCCAGAAAGGAGGGGG - Intergenic
1194094674 X:89623533-89623555 CTGAGTAGACATAGTGAAAGAGG + Intergenic
1196003754 X:110813658-110813680 CGGAGTGTATACAATGAGGGTGG + Intergenic
1196927499 X:120647903-120647925 CAGAGTGAATACAATGAAGGAGG - Intergenic
1199924490 X:152448597-152448619 CTGAGGGGATACAATGCAGTGGG - Intronic
1200447308 Y:3279693-3279715 CTGAGTAGACATAGTGAAAGAGG + Intergenic
1200655885 Y:5901711-5901733 CAGAGTGCAAAGAATGAAGGAGG - Intergenic
1201605343 Y:15778175-15778197 CTGAGGGGACAGAATGAAATGGG - Intergenic