ID: 1022747060

View in Genome Browser
Species Human (GRCh38)
Location 7:33183205-33183227
Sequence GGTGCTGCAGACTCCATTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 1, 2: 8, 3: 32, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022747060_1022747069 25 Left 1022747060 7:33183205-33183227 CCCAAAATGGAGTCTGCAGCACC 0: 1
1: 1
2: 8
3: 32
4: 196
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747060_1022747062 -4 Left 1022747060 7:33183205-33183227 CCCAAAATGGAGTCTGCAGCACC 0: 1
1: 1
2: 8
3: 32
4: 196
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022747060 Original CRISPR GGTGCTGCAGACTCCATTTT GGG (reversed) Intronic
900031345 1:375199-375221 GCTGCTGAGGACTTCATTTTGGG + Intergenic
900051897 1:603399-603421 GCTGCTGAGGACTTCATTTTGGG + Intergenic
900661233 1:3785065-3785087 GGTGCTGCAGCCTCCTTTGCAGG - Exonic
901966646 1:12873784-12873806 GCCTCTGCAGACTCCATTTCTGG - Intronic
903915583 1:26761855-26761877 GTTGCTGAAGACTCAATGTTCGG + Intronic
905958582 1:42022834-42022856 GGTGCTGCAGCTTTGATTTTAGG + Intronic
906859455 1:49343232-49343254 GGTGCCACAGACCCCGTTTTGGG + Intronic
908903373 1:68981431-68981453 GGTGCAGCAGACTCCCTTAGAGG - Intergenic
910285415 1:85548706-85548728 AATTCTGCAGAATCCATTTTGGG - Intronic
912461435 1:109834798-109834820 GGTGCTGCAGACCCCGCTTTGGG + Intergenic
912638480 1:111320944-111320966 TGTGCAGTAGACTCCATTTAGGG + Intergenic
913248100 1:116888084-116888106 AGTGCTGGAGCCACCATTTTGGG + Intergenic
915089717 1:153416003-153416025 GGTGCTGCAATCTCTATTTTAGG - Intergenic
915095790 1:153461137-153461159 GGTGCTTCAATCTCTATTTTAGG + Intergenic
915393725 1:155566290-155566312 GGTACAGCCGACTCCATCTTGGG + Intergenic
916036178 1:160924390-160924412 AGTGCCACAGACCCCATTTTGGG - Intergenic
916162521 1:161932779-161932801 GGTGCTGCAGTCTCATTTTTGGG + Intronic
916367274 1:164045302-164045324 GGAGCTCCAGCCTCCATCTTAGG + Intergenic
916731982 1:167574560-167574582 GGTGCCACAGATTCCATTTGGGG + Intergenic
916954812 1:169820739-169820761 GGTGCTGCAGTCTGCTTTTTGGG + Intronic
923363530 1:233236206-233236228 AGAGCTGCAGATTCAATTTTGGG - Intronic
1064156630 10:12908167-12908189 TGTCCTGGAGACTCCATTTTGGG - Intronic
1065109251 10:22423966-22423988 AGTGCAGCAGCATCCATTTTTGG - Intronic
1069871633 10:71536603-71536625 GGGGCTGGAGACTCACTTTTGGG + Intronic
1074838288 10:117322319-117322341 GGTGCTGCTGACCCCCCTTTTGG + Intronic
1075416702 10:122269540-122269562 GGTGCTGCAGACAGGATTTGAGG - Intergenic
1076230889 10:128819196-128819218 GGCTCTGCAGACTCCACTCTGGG + Intergenic
1077390308 11:2297838-2297860 GGTGCTGCTGATTCCAGTCTTGG + Exonic
1077639015 11:3864414-3864436 GGGGCTGAAGACTCTATTTGGGG + Intronic
1078656859 11:13249099-13249121 AGTCCTGCAGCCTCCATTTGTGG + Intergenic
1078752056 11:14174556-14174578 GGTGCCACAGGCCCCATTTTGGG - Intronic
1079124395 11:17708556-17708578 GGTGGTCCAGTCTCCATGTTGGG + Intergenic
1079412589 11:20203059-20203081 GGTGCCACAGACCCCGTTTTGGG + Intergenic
1080058409 11:27931619-27931641 GGTGCTACAGACCCCGTTTTGGG - Intergenic
1080659695 11:34285755-34285777 GGTGCTTCTGACTGCTTTTTGGG + Intronic
1082228713 11:49739297-49739319 GGTGCCACAGACCCCATTGTGGG - Intergenic
1083687876 11:64388111-64388133 GGAGCTGCAGTAGCCATTTTGGG + Intergenic
1085974577 11:81636783-81636805 GGTGCCACAGACCCCACTTTGGG + Intergenic
1086058814 11:82679716-82679738 GCTGCCGCAGACCCCGTTTTGGG - Intergenic
1086621352 11:88889819-88889841 GGTGCCACAGACCCCATTGTGGG + Intronic
1087262189 11:96023493-96023515 GGTGGTCCAGGCTCCATTCTGGG - Intronic
1088006881 11:104951978-104952000 GGTGGTCCAGCCTCCATATTCGG + Exonic
1088902527 11:114128905-114128927 GGTCCTGCAAACTCTATTTGGGG - Intronic
1094316640 12:29143571-29143593 GGTGCTGTGGACCCCATTTTCGG - Intergenic
1098294032 12:68985904-68985926 GGTGCCACAGACCCCATTTTGGG + Intergenic
1099541949 12:83922153-83922175 GGTGCTGCAAACTTCATTTATGG + Intergenic
1099812508 12:87602432-87602454 GGTGCTGCAAAATCAATTATAGG - Intergenic
1104362156 12:128144133-128144155 TGGGCTGCAGACTCTATTTAAGG - Intergenic
1105274666 13:18908614-18908636 GGTGCCACAGACCCCCTTTTAGG + Intergenic
1107710971 13:43150496-43150518 GTTGCTGCGGAGTCCATCTTTGG + Intergenic
1109345939 13:61114360-61114382 GATGCTACAGACCCCATTTTGGG + Intergenic
1110132802 13:72027986-72028008 TGTGCTGCTAAATCCATTTTCGG - Intergenic
1110144313 13:72170634-72170656 CTTGCTGCTGACGCCATTTTAGG - Intergenic
1113448977 13:110392566-110392588 GCTGCTGCACAATACATTTTTGG - Intronic
1113910597 13:113839540-113839562 GGAGCTGCAGTCTCCTTTCTGGG - Intronic
1113979930 13:114266261-114266283 GGTGCCACAGACCCCGTTTTAGG - Intronic
1114011371 14:18372693-18372715 GGTGATGCAGGCTCTTTTTTTGG - Intergenic
1116680244 14:47959160-47959182 GGTGCTGAGGCCTTCATTTTGGG + Intergenic
1118031940 14:61826590-61826612 TGTCCTGAATACTCCATTTTTGG + Intergenic
1118563082 14:67108087-67108109 GGTGCTGCAGATTCCTTTATTGG - Intronic
1118952152 14:70444815-70444837 GGTGCCACAGATTCCATTTTGGG - Intergenic
1118999506 14:70869454-70869476 AGTGCCACAGATTCCATTTTGGG - Intergenic
1119016568 14:71062802-71062824 AGTCCTGCAAACTCCATTTGTGG + Intronic
1119608501 14:76042041-76042063 AGTGCTGCAGAACCCATTTGTGG + Intronic
1120961538 14:90129513-90129535 GCTGCTCCAGACTCCACTTTGGG + Intronic
1123771224 15:23531351-23531373 GGTGCCACACACTCTATTTTGGG - Intergenic
1125455093 15:39850081-39850103 AGTCCTGCAGACTCCATTCAGGG - Intronic
1125742848 15:41979270-41979292 GTTGTGGCAGACTCCATTTCTGG - Intergenic
1126072773 15:44880282-44880304 GGTGCCACAGACCCCATTCTGGG - Intergenic
1128325184 15:66719537-66719559 GGGGCTGCAGACACCCTGTTTGG - Intronic
1129268614 15:74408106-74408128 GGGGCTGCTGCCACCATTTTTGG - Intergenic
1130037037 15:80370305-80370327 GGTGCCACAGACCCCGTTTTGGG + Intronic
1133495353 16:6312534-6312556 GGCGCTGCAGACCCAATTTCTGG + Intronic
1135055984 16:19232449-19232471 GGGGCTGCAGACCACATTTTGGG + Intronic
1137395566 16:48114353-48114375 GATGCTGCAGCCAGCATTTTAGG - Intronic
1137747492 16:50833900-50833922 GCTGCTGCAGTCTCCTGTTTGGG + Intergenic
1137915139 16:52421838-52421860 GATGTTGCTGACTCCATTTTTGG - Intergenic
1141615963 16:85209575-85209597 GGTGCTGCAGAAGCCGTTTCTGG - Intergenic
1142943383 17:3402640-3402662 GTGGCTGCAGCCTACATTTTGGG + Intergenic
1144513819 17:15901075-15901097 GGTGCTGCAGGCTCCCTCTAGGG + Intergenic
1145193070 17:20864527-20864549 GGTGCTACAAAACCCATTTTAGG - Exonic
1145298952 17:21616592-21616614 GGTGCTACAAAACCCATTTTAGG + Intergenic
1145403483 17:22566529-22566551 GGTGCTACAAAACCCATTTTAGG - Intergenic
1145723437 17:27093308-27093330 GGTGCTACAAAACCCATTTTAGG + Intergenic
1147919033 17:43905457-43905479 GGGGCTGTAGACTCCATGCTTGG - Intronic
1149173676 17:53844012-53844034 GGTGTCACAGACCCCATTTTGGG - Intergenic
1152948308 17:83210514-83210536 GCTGCTGAGGACTTCATTTTGGG - Intergenic
1153496872 18:5708468-5708490 CCTGCTGCAGGCTCCAATTTAGG - Intergenic
1154107740 18:11537601-11537623 GGTGCCACAGACCCCATTTTAGG + Intergenic
1154191229 18:12232288-12232310 GGTGCTGCAGCTTGGATTTTGGG + Intergenic
1154466352 18:14645872-14645894 GGTGCCACAGACCCCCTTTTAGG + Intergenic
1155012434 18:21793194-21793216 GTTCCTGAAGACTCCAGTTTGGG + Intronic
1156041616 18:32829324-32829346 GATGCTGCAGCTTCCATCTTGGG - Intergenic
1156381339 18:36564150-36564172 CCTGCTGCAGAGTCCATTTCTGG + Intronic
1158845894 18:61442488-61442510 GATGCAGCAGACTTGATTTTGGG - Intronic
1159431535 18:68358851-68358873 GATGCCACTGACTCCATTTTGGG + Intergenic
1162461555 19:10816911-10816933 GCTGCTCCAGACTCCAGTGTGGG - Intronic
1165541272 19:36493720-36493742 AGTCCTGCAGCCTCCATTCTTGG - Intergenic
1166402559 19:42494181-42494203 GGTGACACAGACCCCATTTTGGG - Intergenic
1168148374 19:54431758-54431780 TGTCCTGCAGGCTCCAGTTTGGG + Intronic
925471978 2:4172787-4172809 GTTGCCACAGACCCCATTTTGGG - Intergenic
927205119 2:20604062-20604084 GGGCCTGCAGATTCCCTTTTTGG + Intronic
928355376 2:30608501-30608523 AGTCCTGCAGACTCCATTCATGG + Intronic
930333614 2:50017875-50017897 GGTGATTCAGTTTCCATTTTGGG + Intronic
932495834 2:72145308-72145330 GGTTCTGCAGAGTCACTTTTCGG - Intronic
935377026 2:102410144-102410166 GGTGCTAGAGACCCCATTTTGGG + Intergenic
936112079 2:109673394-109673416 GGTGCCACAGACCCCATTTTGGG + Intergenic
937682869 2:124663556-124663578 GTAGTTGCAGAATCCATTTTGGG + Intronic
937953084 2:127403226-127403248 GGGGCTGCAGAGACCATCTTAGG - Intergenic
939255555 2:139740771-139740793 GTTGCTACAGAAGCCATTTTAGG + Intergenic
940889813 2:159024408-159024430 AGTCCTGCAAACTCCATTTGTGG + Intronic
941199723 2:162493019-162493041 GGTGCCACAGACTCCATTTTGGG + Intronic
942017455 2:171831236-171831258 GGTGCCACAGACCCCATTTTAGG + Intronic
942171669 2:173295750-173295772 GGTGCCATAGATTCCATTTTGGG - Intergenic
942218857 2:173749671-173749693 GGTGCTGTAAACTACCTTTTGGG + Intergenic
943544927 2:189263624-189263646 AGTGCTGCAACCTCCATTTATGG + Intergenic
944887478 2:204078476-204078498 AGTGCTGCAGTCTCCACTTCTGG + Intergenic
1170117230 20:12873309-12873331 GTTGCTGCTGACTCCAACTTTGG + Intergenic
1171561581 20:26131678-26131700 GGTGCTACTAACCCCATTTTAGG - Intergenic
1173279858 20:41618339-41618361 GCTGCTGCAGGAGCCATTTTAGG - Exonic
1173752080 20:45485161-45485183 GGTGCCACAGACCCCGTTTTAGG - Intergenic
1175990869 20:62788309-62788331 GGTGCTGCAGAGCCCAGGTTAGG + Intergenic
1176649671 21:9533623-9533645 GGTGCTACAAAACCCATTTTAGG + Intergenic
1176693608 21:9947875-9947897 GGTGCTGCAGACCCCATTTTGGG - Intergenic
1176808235 21:13512729-13512751 GGTGCCACAGACCCCCTTTTAGG - Intergenic
1177414790 21:20779932-20779954 GGTACCACAGATTCCATTTTTGG - Intergenic
1177729406 21:25008657-25008679 GGTCCTGCAAGCTCCATTCTTGG + Intergenic
1178197251 21:30360797-30360819 GGAGCTGCAAACTTCATTCTGGG - Intronic
1180242778 21:46522803-46522825 GGAGCCACAGACCCCATTTTGGG - Intronic
1180435865 22:15303497-15303519 GGTGATGCAGGCTCTTTTTTTGG - Intergenic
1181119484 22:20656423-20656445 GGTGCCATAGACTCCATTTTAGG - Intergenic
1181316783 22:21975718-21975740 GGTCCTTCACACTCCAGTTTCGG + Exonic
1181335933 22:22128434-22128456 GGTGCCACAGACCTCATTTTAGG + Intergenic
1181343897 22:22203287-22203309 GGTGATGCAGCCTCCATCCTGGG - Intergenic
1181680066 22:24488910-24488932 TCTGCTGCAAAATCCATTTTTGG + Intergenic
1181714219 22:24712528-24712550 GGTGGGGGAGACTCCATTCTTGG + Intergenic
1182686705 22:32126363-32126385 GGTGCCACAGACTCCATTTTAGG + Intergenic
1182714902 22:32350102-32350124 GGTGCCAGAGACCCCATTTTAGG - Intergenic
1183325843 22:37193345-37193367 GGTGCTACAGACCCTGTTTTGGG - Intronic
1184310878 22:43641736-43641758 GGTGGTGCAGACTTCAGTGTGGG + Intronic
949649525 3:6139916-6139938 GGTGCTTCAAAATTCATTTTGGG + Intergenic
952294725 3:32051217-32051239 GGCACCACAGACTCCATTTTGGG + Intronic
957196198 3:77071619-77071641 TGTTCTGCAGAATCCATTTGAGG + Intronic
958956159 3:100467533-100467555 AGTGCTACTGACCCCATTTTGGG - Intergenic
958968499 3:100585634-100585656 GGTGCCACAGACTCCATTCTAGG - Intergenic
959686528 3:109153360-109153382 GGTCCTACAGATCCCATTTTAGG + Intergenic
960043807 3:113176984-113177006 GATGCTGCAGAGACCATTTGAGG + Intergenic
960083088 3:113562075-113562097 GAAGCTGCAGACTTCATCTTTGG - Intronic
961748874 3:129083936-129083958 GGTCCTGCTGACTCCATTCATGG + Intergenic
965585825 3:170317395-170317417 GGCGCCACAGACTCCATTTTGGG - Intergenic
965869307 3:173247460-173247482 GGTGCCACAGACCCCATTTTAGG - Intergenic
966412261 3:179655890-179655912 GGTGCTGAAGAATCCCTTATTGG - Intronic
968480250 4:830101-830123 GGTGCTGCTGACTGCATGGTTGG - Intergenic
971300076 4:25434580-25434602 GCTGCTGCTGACACTATTTTGGG + Intergenic
973889964 4:55359010-55359032 GGGCCTGCAGCCTCCGTTTTGGG + Intronic
975756252 4:77574305-77574327 GGTGCCACAGACCCCATTTTGGG + Intronic
976540097 4:86264559-86264581 GGAGCTTCAGACTTCATTGTGGG - Intronic
977589864 4:98814292-98814314 GGTGCTACAGACTCTGCTTTGGG + Intergenic
979425075 4:120554160-120554182 GCTGCTGTAGACTCCCTTTGTGG + Intergenic
980139936 4:128902574-128902596 AGTCCTGCAGGCTCCATTTATGG - Intronic
980366230 4:131808113-131808135 GGTGCCGCAGACCCCATTTTGGG - Intergenic
980642596 4:135599033-135599055 GGTGCAACAGACTCCATTTTGGG + Intergenic
980987861 4:139713339-139713361 GGTGTCACAGACTCCGTTTTGGG - Intronic
981973949 4:150700444-150700466 AGTGCTGCAAACTCCATTCATGG - Intronic
982610733 4:157571540-157571562 TGTGCTGCAGGCTCCAATTCAGG + Intergenic
984327545 4:178272687-178272709 GGTGCCACAGATTCTATTTTGGG + Intergenic
985521477 5:375899-375921 GATGGTGCATTCTCCATTTTTGG - Intronic
986498961 5:8378089-8378111 GGTGATGCAGGCTCTTTTTTGGG - Intergenic
987166133 5:15200518-15200540 GGTGCCACAGACCCCGTTTTGGG - Intergenic
988822678 5:34902992-34903014 GGCCATTCAGACTCCATTTTGGG + Intergenic
990991542 5:61689234-61689256 GGCACTTCAGACTTCATTTTGGG + Intronic
992066773 5:73116757-73116779 GGAGCTTCAGAGTCCATTTGGGG - Intergenic
993120512 5:83768620-83768642 GGTGCCACAGACTCCATTTTGGG + Intergenic
993422446 5:87719191-87719213 GGCGCCACAGACCCCATTTTGGG - Intergenic
996755533 5:126931128-126931150 GGTTCTGCAGACACCAGTGTGGG + Intronic
996980526 5:129487394-129487416 GGTGCTACAGAGTGTATTTTTGG - Intronic
997852682 5:137346711-137346733 TGAGCTGCAAACTCCTTTTTGGG - Intronic
1001517768 5:172367825-172367847 GGTGCTGCAGCAGCCATCTTGGG + Intronic
1002742475 5:181443669-181443691 GCTGCTGAGGACTTCATTTTGGG - Intergenic
1004831107 6:19477406-19477428 GCTTCTGCAGCCTTCATTTTGGG - Intergenic
1004949156 6:20648607-20648629 GGTGCTGCAGTTTTCAATTTTGG + Intronic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006689543 6:35869672-35869694 TGTGCTGCTGTCTCCATTTTGGG + Exonic
1007285849 6:40746820-40746842 GGAGCTGCGGCCTCCATTTGAGG - Intergenic
1008139652 6:47817522-47817544 GGGTCTGCAGACTACATTTTGGG - Intronic
1008280308 6:49588504-49588526 GCTGCTGTAGTCTTCATTTTAGG - Intergenic
1009458049 6:63879559-63879581 GGTGTGGCAGAATCCTTTTTAGG + Intronic
1010917889 6:81643058-81643080 GGTGTTCCAAACTGCATTTTAGG + Intronic
1010991728 6:82486708-82486730 GGTGCCACAGATTCCATTTTAGG + Intergenic
1011886002 6:92096469-92096491 AGTCCTGCAGGCTCCATTTATGG + Intergenic
1013081235 6:106815253-106815275 GGTGCCACAGACCCCATTGTGGG + Intergenic
1016108518 6:140191798-140191820 GGTGCCACAGACTCTGTTTTGGG + Intergenic
1016129717 6:140452453-140452475 GGTCCTGGAGACTTCTTTTTAGG + Intergenic
1016296211 6:142575834-142575856 GGTGCCACAGACCCCATTTTGGG + Intergenic
1018305983 6:162455724-162455746 GGAGCTGCATATTCCATTTGTGG - Intronic
1018921751 6:168180241-168180263 GCTGCTGAAGCCTGCATTTTGGG + Intergenic
1019247611 6:170719408-170719430 GCTGCTGAGGACTTCATTTTGGG - Intergenic
1019974119 7:4566726-4566748 GGAGCTGGAGATTTCATTTTTGG - Intergenic
1021326229 7:19272936-19272958 GAAGCTCCAAACTCCATTTTAGG + Intergenic
1022747060 7:33183205-33183227 GGTGCTGCAGACTCCATTTTGGG - Intronic
1024491223 7:49987456-49987478 GGTGCCACAAATTCCATTTTGGG + Intronic
1025276243 7:57583700-57583722 GGTGCTACTAACCCCATTTTAGG + Intergenic
1026246954 7:68629114-68629136 AGTCCTGCAAACTCCATTTATGG + Intergenic
1026319096 7:69253468-69253490 GGAGCTGGAGAATCCACTTTGGG - Intergenic
1026901622 7:74040487-74040509 GGTACAGCAGGCTCCATGTTTGG + Intronic
1030116136 7:106063664-106063686 CATGCTGTAGACTCCACTTTGGG - Intergenic
1031309812 7:120181772-120181794 GTTGATGCATTCTCCATTTTAGG - Intergenic
1033053524 7:138028459-138028481 GGTGCCACAGACTCCTTTTTGGG - Intronic
1034245527 7:149641470-149641492 GGTGCAGAAGACTTCATGTTAGG + Intergenic
1035500526 8:88528-88550 GCTGCTGAGGACTTCATTTTGGG + Intergenic
1040526371 8:48228784-48228806 GGCACCACAGACTCCATTTTGGG + Intergenic
1043811034 8:84741086-84741108 GTTGCTCCCAACTCCATTTTGGG - Intronic
1046539454 8:115560497-115560519 AATGCTGCTGAATCCATTTTAGG + Intronic
1046697772 8:117361006-117361028 GGTGCTGCTGAGTCCACTTGGGG + Intergenic
1047135326 8:122071381-122071403 TTTGGTGCAGACGCCATTTTAGG + Intergenic
1048292119 8:133189243-133189265 GGAGCTGCAGCAGCCATTTTGGG - Intergenic
1049324599 8:142015456-142015478 GGTGCTTCTGCCTCCATTCTGGG + Intergenic
1050063670 9:1736881-1736903 GGTGCTTCCAATTCCATTTTAGG + Intergenic
1051973065 9:22914143-22914165 GCTGCTGCTGCCTTCATTTTAGG - Intergenic
1053630570 9:39933959-39933981 GGTGCCGCAGACCCCATTTTGGG - Intergenic
1053775198 9:41529550-41529572 GGTGCCGCAGACCCCATTTTGGG + Intergenic
1054213317 9:62316742-62316764 GGTGCCGCAGACCCCATTTTGGG + Intergenic
1056909508 9:90685941-90685963 GGAGTTGCTGACTCCATCTTGGG - Intergenic
1060090081 9:120735070-120735092 GGTGATGCAGCCTCCATCCTTGG + Intergenic
1061830616 9:133291424-133291446 GGTGCTATAGACCCCATTTTGGG - Intergenic
1062721735 9:138047866-138047888 GGTGCTGAAGACTTGAATTTAGG + Intronic
1203608381 Un_KI270748v1:74888-74910 GCTGCTGAGGACTTCATTTTGGG - Intergenic
1203627412 Un_KI270750v1:37171-37193 GGTGCTACAAAACCCATTTTAGG + Intergenic
1185842521 X:3405749-3405771 ATTCCTGCAGACTCTATTTTTGG - Intergenic
1190815637 X:53926740-53926762 GGCGCCACAGACTCCATTTTGGG + Intergenic
1191702569 X:64058975-64058997 GGTGTTGCGGGCTCTATTTTTGG + Intergenic
1192682350 X:73264730-73264752 GGTGTCACAGACCCCATTTTGGG - Intergenic
1195219914 X:102736970-102736992 GGTGCCACAGACCCCGTTTTGGG - Intronic
1195320104 X:103714750-103714772 GGTGCTGCAGACCCCAGGTAAGG + Intronic
1197065497 X:122228656-122228678 GGTGCCACAGATTCCATTTTGGG + Intergenic
1197193711 X:123677253-123677275 GATCCTGCACACTCCATTCTTGG - Intronic
1198076095 X:133194638-133194660 GGTGCTGCAGCATCCCTTGTTGG - Intergenic
1198084313 X:133268154-133268176 GGGTCTGCAGACCCCAGTTTGGG + Intergenic