ID: 1022747062

View in Genome Browser
Species Human (GRCh38)
Location 7:33183224-33183246
Sequence CACCTCCTCTGTTTTTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 19, 1: 36, 2: 67, 3: 95, 4: 413}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022747058_1022747062 -2 Left 1022747058 7:33183203-33183225 CCCCCAAAATGGAGTCTGCAGCA No data
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413
1022747059_1022747062 -3 Left 1022747059 7:33183204-33183226 CCCCAAAATGGAGTCTGCAGCAC 0: 1
1: 1
2: 6
3: 14
4: 153
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413
1022747055_1022747062 26 Left 1022747055 7:33183175-33183197 CCACGAGGGAAACAGATGTCTTT No data
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413
1022747060_1022747062 -4 Left 1022747060 7:33183205-33183227 CCCAAAATGGAGTCTGCAGCACC No data
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413
1022747061_1022747062 -5 Left 1022747061 7:33183206-33183228 CCAAAATGGAGTCTGCAGCACCT 0: 1
1: 1
2: 7
3: 30
4: 195
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413
1022747057_1022747062 -1 Left 1022747057 7:33183202-33183224 CCCCCCAAAATGGAGTCTGCAGC 0: 1
1: 0
2: 0
3: 23
4: 139
Right 1022747062 7:33183224-33183246 CACCTCCTCTGTTTTTCCCAAGG 0: 19
1: 36
2: 67
3: 95
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022747062 Original CRISPR CACCTCCTCTGTTTTTCCCA AGG Intronic