ID: 1022747063 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:33183226-33183248 |
| Sequence | CACCTTGGGAAAAACAGAGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 527 | |||
| Summary | {0: 2, 1: 41, 2: 65, 3: 88, 4: 331} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1022747063_1022747069 | 4 | Left | 1022747063 | 7:33183226-33183248 | CCTCCTCTGTTTTTCCCAAGGTG | 0: 2 1: 41 2: 65 3: 88 4: 331 |
||
| Right | 1022747069 | 7:33183253-33183275 | AAGCTGTTAAATATTATCTTAGG | 0: 1 1: 0 2: 2 3: 27 4: 370 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1022747063 | Original CRISPR | CACCTTGGGAAAAACAGAGG AGG (reversed) | Intronic | ||