ID: 1022747064 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:33183229-33183251 |
Sequence | GGACACCTTGGGAAAAACAG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1022747064_1022747069 | 1 | Left | 1022747064 | 7:33183229-33183251 | CCTCTGTTTTTCCCAAGGTGTCC | No data | ||
Right | 1022747069 | 7:33183253-33183275 | AAGCTGTTAAATATTATCTTAGG | 0: 1 1: 0 2: 2 3: 27 4: 370 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1022747064 | Original CRISPR | GGACACCTTGGGAAAAACAG AGG (reversed) | Intronic | ||