ID: 1022747069

View in Genome Browser
Species Human (GRCh38)
Location 7:33183253-33183275
Sequence AAGCTGTTAAATATTATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 370}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022747064_1022747069 1 Left 1022747064 7:33183229-33183251 CCTCTGTTTTTCCCAAGGTGTCC No data
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747065_1022747069 -10 Left 1022747065 7:33183240-33183262 CCCAAGGTGTCCCAAGCTGTTAA No data
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747057_1022747069 28 Left 1022747057 7:33183202-33183224 CCCCCCAAAATGGAGTCTGCAGC 0: 1
1: 0
2: 0
3: 23
4: 139
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747063_1022747069 4 Left 1022747063 7:33183226-33183248 CCTCCTCTGTTTTTCCCAAGGTG 0: 2
1: 41
2: 65
3: 88
4: 331
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747059_1022747069 26 Left 1022747059 7:33183204-33183226 CCCCAAAATGGAGTCTGCAGCAC 0: 1
1: 1
2: 6
3: 14
4: 153
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747060_1022747069 25 Left 1022747060 7:33183205-33183227 CCCAAAATGGAGTCTGCAGCACC No data
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747061_1022747069 24 Left 1022747061 7:33183206-33183228 CCAAAATGGAGTCTGCAGCACCT 0: 1
1: 1
2: 7
3: 30
4: 195
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370
1022747058_1022747069 27 Left 1022747058 7:33183203-33183225 CCCCCAAAATGGAGTCTGCAGCA No data
Right 1022747069 7:33183253-33183275 AAGCTGTTAAATATTATCTTAGG 0: 1
1: 0
2: 2
3: 27
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022747069 Original CRISPR AAGCTGTTAAATATTATCTT AGG Intronic