ID: 1022749992

View in Genome Browser
Species Human (GRCh38)
Location 7:33214290-33214312
Sequence AGGGACAGCACAGTGACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 19, 3: 64, 4: 321}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022749992_1022750000 14 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022750000 7:33214327-33214349 GACTCTACACTGGGGTATGAGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1022749992_1022749997 5 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022749997 7:33214318-33214340 AAGTGCACAGACTCTACACTGGG No data
1022749992_1022749999 13 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022749999 7:33214326-33214348 AGACTCTACACTGGGGTATGAGG No data
1022749992_1022750001 17 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022750001 7:33214330-33214352 TCTACACTGGGGTATGAGGGAGG 0: 1
1: 0
2: 2
3: 12
4: 179
1022749992_1022750002 18 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022750002 7:33214331-33214353 CTACACTGGGGTATGAGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 233
1022749992_1022750003 19 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022750003 7:33214332-33214354 TACACTGGGGTATGAGGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 311
1022749992_1022749998 6 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022749998 7:33214319-33214341 AGTGCACAGACTCTACACTGGGG No data
1022749992_1022750004 22 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022750004 7:33214335-33214357 ACTGGGGTATGAGGGAGGGGAGG 0: 1
1: 0
2: 13
3: 104
4: 729
1022749992_1022749996 4 Left 1022749992 7:33214290-33214312 CCTCAAGTCACTGTGCTGTCCCT 0: 1
1: 0
2: 19
3: 64
4: 321
Right 1022749996 7:33214317-33214339 GAAGTGCACAGACTCTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022749992 Original CRISPR AGGGACAGCACAGTGACTTG AGG (reversed) Intronic
901316555 1:8313960-8313982 TGGGACGGCACAGTCCCTTGAGG + Intergenic
901493003 1:9606107-9606129 CGGGACAGCGCAGCGACTTCAGG - Intronic
902558320 1:17260244-17260266 ACGGACAGCAAAGCGCCTTGGGG - Intronic
902960535 1:19960049-19960071 AGCAACAGCTCATTGACTTGTGG - Intergenic
904647330 1:31977744-31977766 AGGGACAGCACAGTGGCCCGGGG + Intergenic
904929458 1:34074844-34074866 AGGGACAACTGAGTTACTTGAGG + Intronic
905306594 1:37023396-37023418 GGGGAAAGCACAGTGCCTTCTGG + Intronic
905338519 1:37262005-37262027 TGGGACAGGAAAGTGACCTGGGG + Intergenic
905507305 1:38490130-38490152 AGGGAGATCAGAGTGACTAGAGG + Intergenic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
909111457 1:71483395-71483417 AGGGCAAGCACAGTAACATGGGG + Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
911089564 1:94007658-94007680 GGGGACACCACAGTGACCTCAGG - Exonic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
915484545 1:156211206-156211228 AGGGACAGGGAAGTGGCTTGTGG - Exonic
915946427 1:160155690-160155712 AGGGACTGCAAAGTGCTTTGGGG - Intronic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917414011 1:174789605-174789627 AGACACAACACAGTAACTTGTGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919779848 1:201214677-201214699 AGAGACATCACAGTGACTCAGGG + Intronic
920143219 1:203835731-203835753 AAGGACAACACAGTGACTCCTGG - Intronic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920852886 1:209640600-209640622 AGGGAATGCACAGTGAGTGGTGG - Intronic
921812715 1:219532730-219532752 AGGGACAGCACAGAGGCCAGTGG + Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923133477 1:231097383-231097405 GGACACAGCACAGTGACTTCAGG - Intergenic
923613206 1:235513549-235513571 AGGGAGAGTACTGTGAGTTGAGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063071430 10:2670577-2670599 AAGGACCGCACAGTGGGTTGAGG + Intergenic
1063150951 10:3335813-3335835 AGTGACAGGACAGGGAATTGAGG + Intergenic
1063707640 10:8446491-8446513 AGGGGCAGAAACGTGACTTGTGG + Intergenic
1065421780 10:25552746-25552768 AGGTACAGCACAGTGAGTCAGGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070044929 10:72823777-72823799 AGGGCCAGCACAGTGCCTCACGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1070279398 10:75037802-75037824 AGGGCCAGCAGAGGCACTTGGGG - Intergenic
1070391381 10:75973766-75973788 AATGACAGCACCGTGACTTGGGG + Intronic
1071770661 10:88726142-88726164 AGGGAAACCACAGGGAATTGTGG - Intronic
1071893370 10:90037462-90037484 AGGGGCAGCATAGGGACTAGCGG + Intergenic
1072089502 10:92113596-92113618 AGGGAATGCCCAGTGAGTTGGGG + Intronic
1073042669 10:100618077-100618099 AGAGAGAGGACAGTGCCTTGAGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1073989722 10:109248737-109248759 AGAGCCAGCACATTGACTTTAGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1076138427 10:128060855-128060877 AGAGACAGCACTGTGATTTCTGG + Intronic
1076453068 10:130570340-130570362 AGGAAAAGCAGAGTGGCTTGAGG + Intergenic
1077391460 11:2302422-2302444 AGGGGCAGCACAGAGCCTGGAGG + Intronic
1077954085 11:6994641-6994663 AGTGACAGCACAGTGGCTGAAGG - Intergenic
1079139708 11:17799926-17799948 AGTGACAGCACAGGGAGATGAGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1080707252 11:34707941-34707963 AGGGCAAGCACAGTGACTAGGGG - Intergenic
1080939737 11:36902067-36902089 AGGCACAGCACTGTGAGTTGTGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081587597 11:44398121-44398143 AGGGCGGGCACAGGGACTTGCGG - Intergenic
1083618587 11:64038030-64038052 AGTGACAGCACACTGGCTGGTGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087811204 11:102610965-102610987 AGGGAAAGCAGTGTGACTCGGGG - Intronic
1088561539 11:111120648-111120670 AGGGGCAGCACTGAGTCTTGAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089535294 11:119157161-119157183 AGGAACAGCACTGTGACCTTAGG + Intronic
1092296733 12:7206162-7206184 AGGGCCAGCACACTGGCTTGTGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093083613 12:14841974-14841996 AGGGACAGCAGAGTGAGTCAAGG + Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094419680 12:30257476-30257498 AGGGAGAGCACAGTAACTATAGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095909813 12:47414742-47414764 AGGGACAGGTCAGGGACTAGTGG - Intergenic
1096225375 12:49863333-49863355 AAGGACACCACAGTGACTCCTGG + Intergenic
1097008888 12:55938549-55938571 CTGGACAGCTCAGTGAGTTGGGG + Exonic
1097240617 12:57572574-57572596 AGGGACAGCATGGTGGCCTGGGG - Exonic
1097290370 12:57909317-57909339 AGGGACATCACATTGTCATGCGG - Intergenic
1097346245 12:58496447-58496469 GTGGACACCACAGTGTCTTGTGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099610208 12:84858035-84858057 AGGGAAAGCACAGTGACTAAGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099885416 12:88524004-88524026 AGGAACAGCACAGGGGTTTGGGG + Intronic
1100282190 12:93128482-93128504 GGCGCCAGCACAGTGACTGGAGG - Intergenic
1101295845 12:103423119-103423141 AGGGACAACACAGTGACCCATGG - Intronic
1102666542 12:114578838-114578860 TGGGACAGCTCTGTGACTTTAGG + Intergenic
1103865557 12:124049268-124049290 AGGGACAGCAGGGTGTGTTGAGG - Intronic
1105965450 13:25379788-25379810 ATGGACAGCAGAGTAACCTGGGG - Intronic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1108997132 13:56748224-56748246 AGGGAAAACACAATGAATTGAGG - Intergenic
1109405278 13:61889882-61889904 AGGGTCAGCACTGTCACTTAAGG + Intergenic
1110431517 13:75429419-75429441 ATGTACAGCAGAGTGATTTGAGG + Intronic
1111484021 13:88871541-88871563 TGGGACAGCAAAGAGATTTGAGG + Intergenic
1111868937 13:93805991-93806013 AAGGAGAGCACAGTGACCTAAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1113616958 13:111686956-111686978 AGAAATAGCACAGTGTCTTGGGG + Intergenic
1113622488 13:111772227-111772249 AGAAATAGCACAGTGTCTTGGGG + Intergenic
1114317930 14:21524725-21524747 ACTGGCAGCACAGTGTCTTGGGG - Exonic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115286348 14:31717206-31717228 AGAGACAGCAAAGTGAATTCAGG - Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116489938 14:45493316-45493338 AGGGAAAGCACAGCAATTTGAGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117557959 14:56906099-56906121 AGGGACAGAGCAGTGGCTTAAGG + Intergenic
1118194086 14:63608527-63608549 TGGGACAGGAAAGGGACTTGAGG - Intronic
1119131324 14:72175737-72175759 AGGGTCAGCACAGTGCCCAGCGG + Intronic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1121955102 14:98206282-98206304 AGGACCAGCAAAGTAACTTGGGG + Intergenic
1122070280 14:99201559-99201581 AGGGCCAGGACAGGGACTGGGGG - Intronic
1122623186 14:103071201-103071223 CTGGACAGGACAGTGACTTCTGG - Intergenic
1122764320 14:104055001-104055023 AGAGACAGCAGAGTGACCAGAGG + Intergenic
1124708038 15:31981828-31981850 AGAGACAGCCCAGCGCCTTGCGG + Intergenic
1125928334 15:43581989-43582011 GGGGACAGAACAGAGAGTTGAGG - Intronic
1125941500 15:43681824-43681846 GGGGACAGAACAGAGAGTTGAGG - Intergenic
1126428057 15:48550668-48550690 AGAAACAGCACCGTGAGTTGAGG - Intronic
1126487302 15:49195720-49195742 AGGGAAAGGAGACTGACTTGGGG + Intronic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1130295666 15:82646228-82646250 AGGGACCGCACCGTCACCTGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1132977090 16:2716293-2716315 ACGGGCAGCACAGAGCCTTGAGG - Intronic
1134027420 16:10964961-10964983 ATGTACAGCACAGTGACTACAGG - Intronic
1134066449 16:11231602-11231624 GAGGACAGCAAAGTGAATTGGGG - Intergenic
1134407164 16:13970585-13970607 TGGGACAGCACAGTGATTGCAGG - Intergenic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137930709 16:52584634-52584656 TGGGACAGCACGGTCCCTTGTGG + Intergenic
1138491143 16:57377393-57377415 AAGGACAGCCCTGTGACCTGGGG + Intronic
1143058391 17:4179747-4179769 AGAGACAGTACAGTGTCTTCTGG - Exonic
1143405702 17:6675831-6675853 AGTAACAGCACAATGTCTTGAGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146242678 17:31244616-31244638 ACGGACAGCACAGTGATTATGGG - Intronic
1146695325 17:34904801-34904823 AGGGGCAGGTCAGAGACTTGGGG - Intergenic
1146991968 17:37282233-37282255 AGGAACAACACAGAGAATTGTGG - Intronic
1147121283 17:38336642-38336664 AATGACAGCACAGTGAGATGGGG - Intronic
1149332596 17:55601997-55602019 AGAGAGAGCTCAGTGGCTTGTGG - Intergenic
1152430560 17:80246312-80246334 CGGGACTGCACAGGGACTTGGGG + Intronic
1154014886 18:10607515-10607537 AGGGAAAGCAAAGGGGCTTGGGG + Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1154105435 18:11518686-11518708 AGGAACAGCACACTGACATCTGG + Intergenic
1154190606 18:12228063-12228085 AGGGAAAGCAAAGGGGCTTGGGG - Intergenic
1155393821 18:25365587-25365609 AAGGAAAGCACACTGCCTTGAGG + Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156045219 18:32870456-32870478 AGGTACAGTGCAGTGACTTAGGG - Intergenic
1156783048 18:40875400-40875422 CGGGAAAGCACAGTGGCATGTGG - Intergenic
1156908839 18:42386850-42386872 AGAGAGATCACAATGACTTGGGG - Intergenic
1156977356 18:43238629-43238651 AGGGGCAACACAGTGACTGGAGG - Intergenic
1158025099 18:52886464-52886486 ACAGACAGCACAGCGACTGGGGG - Intronic
1159118193 18:64139264-64139286 AGGCACAGCAGTGTGATTTGAGG - Intergenic
1159215968 18:65390888-65390910 AGCGATAGCAAAGTGACTTCAGG - Intergenic
1160191897 18:76721661-76721683 ATTGACATCACAATGACTTGGGG - Intergenic
1160822785 19:1066232-1066254 GGGGACAGCAGGGAGACTTGGGG + Intronic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1164502257 19:28829895-28829917 AGCAACTGCACAGTGAGTTGAGG - Intergenic
1166301859 19:41915587-41915609 GGGGACAGGACAGGGACTTGAGG - Intronic
1166718328 19:44983268-44983290 GGGGACAGGATAGAGACTTGAGG + Intronic
926411946 2:12613706-12613728 AGAGACAGCACAAAGCCTTGTGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927519157 2:23688857-23688879 AGGGACAGAACAGCCACCTGTGG + Intronic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
929297147 2:40261213-40261235 AGAGACTCCACAGGGACTTGTGG - Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
933894422 2:86797584-86797606 AGGGGCAGCATGGGGACTTGTGG + Intronic
934916647 2:98305661-98305683 CTGGACAGCTCCGTGACTTGTGG - Intronic
935148332 2:100411863-100411885 TGGGACAGCACAGTTACCTAAGG + Intronic
935352444 2:102164267-102164289 AGGCAAAGCCCAGTGAGTTGAGG - Intronic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
937262317 2:120594436-120594458 AGGCTCAGCACAGTCTCTTGGGG + Intergenic
938722916 2:134082249-134082271 AGGCACAGTACAGGGACTTTTGG - Intergenic
939790595 2:146569643-146569665 AGGTACAGCACAATGACTTATGG + Intergenic
939994239 2:148905577-148905599 GGTGATAGCACAGTGAGTTGAGG + Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
940905036 2:159161234-159161256 AGGGAGAGCACTTTGACTTTTGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
946155433 2:217803901-217803923 AGGCACAGCAAAGAGACCTGAGG + Exonic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947568795 2:231214550-231214572 AGGCACAGAACAAAGACTTGGGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169933523 20:10858622-10858644 AGGCACAGCACAATCACTGGAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172694265 20:36811118-36811140 GTGGAAGGCACAGTGACTTGAGG + Intronic
1174691686 20:52512472-52512494 AGGGAAAGGACACTGACTTGGGG - Intergenic
1176889559 21:14298197-14298219 AGGGACAGGACTGAGAGTTGGGG - Intergenic
1177358962 21:20045003-20045025 TGTGACAGCAAAGTGACGTGGGG - Intergenic
1177859477 21:26436040-26436062 AAGGCCAGAACAGTGACTTCAGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1178268924 21:31171770-31171792 AGAGACTGCAAAGTCACTTGAGG - Intronic
1179025648 21:37676458-37676480 GTGGACAGCCCAGTGCCTTGTGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1182478724 22:30592196-30592218 AGGGACAGCGCGGTGCCTTCTGG + Intronic
1182508341 22:30801739-30801761 TGAGACAGCAGAGTCACTTGAGG + Intronic
1183237665 22:36631647-36631669 TGAGACAGGACAGTGCCTTGGGG - Intronic
1183257945 22:36775154-36775176 TGGGGCAGCACAGTAACTTTGGG + Intronic
1184554855 22:45227607-45227629 AGTGACAGCCCGGTGACGTGAGG - Intronic
1185043113 22:48515753-48515775 AGGGACAGTGCGGGGACTTGGGG + Intronic
1185305885 22:50115879-50115901 ACGGACAGCACAGTGTGCTGAGG + Intronic
949962388 3:9323194-9323216 AGGGACAGCACAGGGAGTTTTGG + Intronic
950739018 3:15034808-15034830 AGGTAGGGCACAGGGACTTGGGG + Exonic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953519757 3:43630561-43630583 AGGGGCAGCAATGTTACTTGGGG - Intronic
953643941 3:44736183-44736205 AAGGAGAGAACAGTGTCTTGGGG + Exonic
953957063 3:47239883-47239905 AGGGAAAGCCCAGTAACCTGTGG + Intronic
954328666 3:49877494-49877516 GGTGACATCACAGTGACCTGGGG + Intergenic
956488825 3:69750107-69750129 AAGGACAGCAGATTGACATGTGG - Intronic
956998783 3:74859423-74859445 AGGGCCAGCATAGGGACTTCTGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957538098 3:81532020-81532042 AGGGAAAACACAGTGACTGTGGG - Intronic
957854831 3:85860975-85860997 GGGGACAGCAGTGTGACATGAGG + Intronic
959409150 3:105998399-105998421 AGGGACAGCACAGCAACTCTGGG - Intergenic
959562718 3:107800874-107800896 ATGGACAGCACTGTGCCCTGAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960639387 3:119811732-119811754 AGGAACTGCACAGTGACCCGAGG + Intronic
962215559 3:133517870-133517892 AGGGGCAGGACAGAGACGTGGGG + Intergenic
962709018 3:138070126-138070148 AGGGAGGGGACAGGGACTTGGGG - Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965617012 3:170604228-170604250 GGGGGCAGCACAGTGAGTAGAGG + Intronic
965805348 3:172536196-172536218 AAGGACAGCACCGTGCCGTGAGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967722283 3:192828281-192828303 AAGGGCAGCACAGTGAAGTGTGG + Intronic
967973912 3:195020291-195020313 AGGAACAGCAGAGTGAAGTGAGG - Intergenic
969197783 4:5576849-5576871 AGGCACAGGACAGTGATTTCAGG - Intronic
969291722 4:6244403-6244425 TGGGCCACCACGGTGACTTGGGG + Intergenic
969628770 4:8323115-8323137 AGGGACAGCACCGAGACCTAGGG - Intergenic
969786220 4:9459348-9459370 AGGGACAGCAAAGTGAGGAGTGG - Intergenic
970210205 4:13701971-13701993 AGGCACTACATAGTGACTTGTGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973507250 4:51408903-51408925 AGGTTCAGCTCAGTGAATTGAGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978733686 4:112061326-112061348 AGGGACAGCACAGTGATCATGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
981478433 4:145211218-145211240 TGGGGCAGCACAGAGACTTCTGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
985478553 5:92799-92821 TGGGACAGAACAGTGATCTGTGG + Intergenic
985721421 5:1491440-1491462 AAGAACAGAACAGTGACGTGGGG + Intronic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
988120065 5:26950027-26950049 TGGGACATCAGAGTGAATTGGGG + Intronic
988771978 5:34441246-34441268 AGGGGGAGCACTGTTACTTGTGG + Intergenic
992134044 5:73724525-73724547 AGGGGCAGCACAGGGAATTTTGG - Intronic
992185009 5:74235466-74235488 AGAGAAAGCACAGAGAGTTGGGG - Intergenic
992742805 5:79790913-79790935 AGGGACAGCACTGGTCCTTGTGG + Intronic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997437824 5:133887703-133887725 AGGGACAGTCCAGTGACTGTGGG + Intergenic
997719603 5:136067001-136067023 AGGCACAGCACACCCACTTGTGG + Intergenic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
1006225906 6:32535740-32535762 AGAGACAGGACAGGGACATGAGG + Intergenic
1007951989 6:45880644-45880666 AGGGCCACCAGAGTCACTTGGGG + Intergenic
1008440257 6:51524760-51524782 AGGGAGTGCACAGGGAGTTGAGG - Intergenic
1008940396 6:57040183-57040205 AGGGAAAGCACAGCAACTGGAGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1014919925 6:127202085-127202107 AGGGACAGCACAGTGCCCCAGGG - Intergenic
1014948238 6:127522058-127522080 GGGGACAGTACACTTACTTGCGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017387244 6:153900692-153900714 AGGGAGAACACAGTGAACTGGGG + Intergenic
1017924847 6:158901826-158901848 AGGGAGAGCACAGCAACTAGGGG - Intronic
1018882279 6:167896317-167896339 ATGGACAGCAGAATTACTTGGGG + Intronic
1020624195 7:10557901-10557923 AGGGAAAGCACAGCAACTGGGGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1023023483 7:36031232-36031254 AGGGAGAGAACACTCACTTGTGG + Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025012222 7:55406578-55406600 AGGGTCTGCTCAGTGAGTTGGGG + Intronic
1025639394 7:63353044-63353066 AGGGACAGCTCAGTCAGGTGAGG - Intergenic
1025643305 7:63395048-63395070 AGGGACAGCTCAGTCAGGTGAGG + Intergenic
1026888613 7:73969270-73969292 AATGACAGCACAGGGATTTGGGG + Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031417366 7:121509826-121509848 GGGGAGAGCAGAGTGAGTTGGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032912216 7:136446304-136446326 GGTGACTGCACAGTGACTTGTGG + Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035170621 7:157015411-157015433 AGGGTCAAGCCAGTGACTTGGGG - Intergenic
1035264379 7:157683037-157683059 AGGGCCAGCACAGCGTCCTGTGG - Intronic
1035355747 7:158275177-158275199 AGGGACAGCACCGTGGCTGTGGG + Intronic
1035577212 8:715508-715530 GGGGCCACCACAGTGACTGGGGG + Intronic
1038815013 8:30893419-30893441 ATGGACAGTACAATGACTTACGG + Intergenic
1039189288 8:34953760-34953782 AGGGAAAGAACAGTGCATTGAGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1040745520 8:50636566-50636588 AAGGAGAGCATAGTGACTTTGGG - Intronic
1040801497 8:51346634-51346656 AGGCACAGCACAAAGACGTGAGG - Intronic
1040929994 8:52723551-52723573 AGGGACAGAATAGTGACTGTTGG - Intronic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1042575961 8:70219107-70219129 AGGGACAGCACTGGGACATAGGG + Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044725612 8:95192147-95192169 GGGGACAGAGCAGTGGCTTGAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047474966 8:125218335-125218357 TTGAATAGCACAGTGACTTGGGG - Intronic
1047524412 8:125620152-125620174 AGGGCCAGCACAGTCATTAGTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048375111 8:133816509-133816531 AAGGACTGCACAGAGACTGGTGG + Intergenic
1048708181 8:137178167-137178189 AGGTACAGCACTGTGGTTTGGGG + Intergenic
1048982550 8:139710638-139710660 GGTGACAGCATAGTGACTGGTGG + Intergenic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049511202 8:143027384-143027406 AGGGCCAGCAGAGTGACCCGTGG - Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050620799 9:7450062-7450084 AAGGTCAGCCCAGTGACTGGCGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051880946 9:21839433-21839455 AGGCAAAATACAGTGACTTGGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1053535118 9:38917709-38917731 GGGCACAGCCCAGTGACTTTAGG - Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054207341 9:62142116-62142138 GGGCACAGCCCAGTGACTTTAGG - Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054631012 9:67446238-67446260 GGGCACAGCCCAGTGACTTTAGG + Intergenic
1055688607 9:78805579-78805601 CGTCACAGCACAGTGACTTAGGG + Intergenic
1058356230 9:104086304-104086326 ATGGACAGGACAATTACTTGAGG + Intergenic
1058744858 9:107980539-107980561 AAAGACAGCAGTGTGACTTGAGG - Intergenic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060564176 9:124575043-124575065 AGGAACATCACAGTGACTCAAGG - Intronic
1060972806 9:127748457-127748479 AGGGAAACCACAGAAACTTGGGG + Intronic
1061481621 9:130900284-130900306 AGGGCCAGCACAGCGACTGGTGG - Intergenic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061767070 9:132888191-132888213 AGGCACAGCAGAGTCACCTGGGG - Intronic
1062401940 9:136376638-136376660 AGGGAGTGCACAGTCACGTGTGG - Intronic
1062643196 9:137532745-137532767 GGGGTCAGGAAAGTGACTTGGGG - Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186276054 X:7939180-7939202 AGAGACAGCACAGAGCCTTCTGG + Intergenic
1186399072 X:9240344-9240366 TGGGACAGGACAGAGGCTTGTGG + Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1186607786 X:11110065-11110087 TGGGACAGAAAAGTGAATTGTGG + Intergenic
1187346758 X:18472504-18472526 AAGGACAGCACAATGTCTTATGG - Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188625199 X:32276065-32276087 AGGGACAGTACAGCTACTGGGGG + Intronic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1190537135 X:51440588-51440610 AGGGACAGCACAGCAACTGGGGG + Intergenic
1191224806 X:58031698-58031720 AGAGAGTGCACAGTGACTAGAGG - Intergenic
1192134944 X:68588515-68588537 AGGAAGAACACAGTGACTAGGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192544361 X:72001056-72001078 AGGGAGAGCACAGAGATGTGTGG - Intergenic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198037672 X:132817759-132817781 AGTGACAGCACTGGGATTTGAGG - Intronic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1200370089 X:155715867-155715889 AGGGCAAGCACAGCGACTGGGGG - Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic