ID: 1022753305

View in Genome Browser
Species Human (GRCh38)
Location 7:33255578-33255600
Sequence TGATGCCCTTAGTGGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022753301_1022753305 -4 Left 1022753301 7:33255559-33255581 CCATAATTAAAATAAGAATTGAT 0: 1
1: 0
2: 3
3: 53
4: 655
Right 1022753305 7:33255578-33255600 TGATGCCCTTAGTGGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022753305 Original CRISPR TGATGCCCTTAGTGGGACCT GGG Intronic
No off target data available for this crispr