ID: 1022760144

View in Genome Browser
Species Human (GRCh38)
Location 7:33339910-33339932
Sequence TCCAATACACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022760139_1022760144 -8 Left 1022760139 7:33339895-33339917 CCACAAAATTAGGGTTCCAATAC 0: 1
1: 0
2: 1
3: 13
4: 506
Right 1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022760144 Original CRISPR TCCAATACACAGAGGGAGGA GGG Intronic
No off target data available for this crispr