ID: 1022763533

View in Genome Browser
Species Human (GRCh38)
Location 7:33383229-33383251
Sequence TTATGCTGATTGCAGTATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022763533 Original CRISPR TTATGCTGATTGCAGTATCC AGG Intronic
904346565 1:29875897-29875919 TTATCCTGATTGGAGGCTCCTGG - Intergenic
906479944 1:46193325-46193347 TGATGCTGATGGGAGTATGCTGG + Exonic
908364608 1:63407074-63407096 TTATGCATCTTGCTGTATCCAGG + Exonic
909973578 1:82020187-82020209 GTAAGCTCATTGCCGTATCCTGG - Intergenic
910152657 1:84170265-84170287 TTATGATCCTTGCAGGATCCTGG - Intronic
916833270 1:168514487-168514509 ATATGCTGATTGGAAAATCCAGG - Intergenic
1064701211 10:18023657-18023679 TTATGCTGGTTGCAGTGTGCTGG + Intronic
1067041819 10:42958108-42958130 TGATGCTGATTGCAGACTTCTGG + Intergenic
1071747168 10:88435289-88435311 GTATGCTCATTGCAGTGTGCTGG - Intronic
1076073490 10:127513013-127513035 CTTTGCTGATTGCAAGATCCTGG - Intergenic
1076245826 10:128946765-128946787 TTATGTTCATGGCAGTTTCCTGG - Intergenic
1077772304 11:5233211-5233233 TTATGCTGATGGGAATAACCTGG - Intronic
1078334979 11:10456086-10456108 GTATCCTGAATGCAGTGTCCTGG - Intronic
1078347096 11:10559946-10559968 TAATGCTCATTGCATGATCCAGG + Intronic
1080855085 11:36105085-36105107 TTATCTTGCTTGCTGTATCCTGG + Intronic
1081280532 11:41204307-41204329 TTATGCTGGTTTCAGTAGGCTGG - Intronic
1082056252 11:47819513-47819535 GTATGCTGTTGGCAGTATCTGGG + Intronic
1082670479 11:56030742-56030764 TGATGCTGAGTGCCTTATCCTGG + Exonic
1084386703 11:68847576-68847598 TTATGCTGGTTGTAGGCTCCAGG - Intergenic
1085384807 11:76151315-76151337 TTTTTCTGATTGCATTTTCCTGG - Intergenic
1085959887 11:81449336-81449358 TTATGCTTCTTGCAGAATGCTGG + Intergenic
1087917013 11:103822885-103822907 TTTTCCTGATTCCAGTATACAGG + Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1091032190 11:132200516-132200538 TTATGCTGACTGCAGTAAGAAGG - Intronic
1093279174 12:17170085-17170107 TGATTCTGATTGCAGTAATCTGG + Intergenic
1094409717 12:30156348-30156370 TTATGATGTATGCAGTTTCCTGG - Intergenic
1094795537 12:33967300-33967322 TTATGGTAATTGCAGCCTCCTGG - Intergenic
1095108172 12:38260327-38260349 TTATGGTAATTGCAGCCTCCTGG - Intergenic
1098583476 12:72129677-72129699 TTTAACTGATTGCAGTATCCAGG - Intronic
1099143404 12:79008685-79008707 TACTGCTGATTCCAGGATCCTGG - Intronic
1100016570 12:90017764-90017786 TCAGGTTGATTGCAGAATCCAGG + Intergenic
1104314137 12:127681284-127681306 TTATGTTGATTGCAGCCTTCTGG + Intergenic
1106868522 13:33994022-33994044 TTAGGCTTATTGCAGTTTCAAGG + Intergenic
1108164271 13:47675944-47675966 TCATGCTGATTCCAGGAGCCTGG + Intergenic
1108458827 13:50644601-50644623 TTATGCTGGTTGCAGGGTCAAGG - Intronic
1111476509 13:88756062-88756084 TTATGATGATTTCAGTAGTCAGG + Intergenic
1111557539 13:89901133-89901155 TTGTGCTGAGTGCACTGTCCTGG + Intergenic
1112678527 13:101733638-101733660 TTATCCTGATTACAGGACCCAGG + Intronic
1113141684 13:107159309-107159331 GTTTGCTGACTGCAGAATCCTGG + Intergenic
1115261445 14:31458245-31458267 TTACCCTGATTGCATTACCCAGG + Intergenic
1116628904 14:47304019-47304041 TCATGATGACTGCAGTATGCAGG - Intronic
1119219687 14:72896020-72896042 TTATGCTGGTTTCTGCATCCAGG - Intergenic
1120795585 14:88629793-88629815 GTATGCTGTTCTCAGTATCCAGG + Intronic
1124651540 15:31477726-31477748 TCTTGCTCATTGCTGTATCCTGG - Exonic
1125390991 15:39192792-39192814 TTCAGCTGAGTGCAGTTTCCTGG - Intergenic
1126986396 15:54315422-54315444 TTATCCTGATTCCAGTTTCCTGG + Intronic
1131855520 15:96589345-96589367 TTATGTTGATAGCAGTGTGCTGG + Intergenic
1133991364 16:10710034-10710056 TTATGCTGTATGTAATATCCAGG - Intergenic
1133992201 16:10717348-10717370 TTGTGATGTTTGTAGTATCCAGG - Intergenic
1134836554 16:17366245-17366267 TTCTGTTGCTTGCAGTAGCCAGG - Intronic
1135157573 16:20066291-20066313 TGATTCTGACTGCATTATCCAGG + Intronic
1139189033 16:64840324-64840346 TTATGATAATTGCGGTATACTGG + Intergenic
1159372827 18:67551105-67551127 TTCTGCTCAGTGCAGTATCAAGG + Intergenic
1164840164 19:31387290-31387312 TGATGCTGAGTTCAGTCTCCTGG - Intergenic
1166513190 19:43425044-43425066 TTGTGCTGTTTCCAGTATACAGG + Intergenic
1167288443 19:48611991-48612013 TTATGCTGCCTGCAAGATCCAGG - Intronic
928407069 2:31022894-31022916 GCATGCTGATAGCAGTAGCCTGG - Intronic
937127772 2:119485197-119485219 TAATTCTGATTGCATTCTCCTGG - Intronic
938272607 2:129987995-129988017 TTATGCTGATTGTAATATAGAGG - Intergenic
939431834 2:142119610-142119632 TTAAGCTGATTGAATTACCCTGG - Intronic
939554546 2:143658680-143658702 TAATGCTGATTGCAGCATTGTGG + Intronic
943631841 2:190262458-190262480 TGATGCTGATGGCAGGATCTAGG - Intronic
946676610 2:222167289-222167311 TTTTGCTGATTGCAAACTCCTGG - Intergenic
946704162 2:222440991-222441013 TTATGCTGAATACACTTTCCTGG - Intronic
946797027 2:223365600-223365622 TTTTTCTGATTCCAGTAACCAGG + Intergenic
946971047 2:225092162-225092184 TTTGGCTGATTGCATTTTCCTGG + Intergenic
1170036938 20:11999472-11999494 TTATGCTGCTTGCAATTTTCTGG + Intergenic
1173489310 20:43466818-43466840 TTTTGCTGATTGCAATCTCATGG + Intergenic
1174722317 20:52826183-52826205 CTATGTGTATTGCAGTATCCTGG - Intergenic
1175634680 20:60570457-60570479 TCATGCTGAGTGCAGTAAGCTGG + Intergenic
1176342495 21:5711391-5711413 GTCTGCTGATTGCAACATCCTGG + Intergenic
1176474749 21:7143542-7143564 GTCTGCTGATTGCAACATCCTGG + Intergenic
1176502332 21:7613065-7613087 GTCTGCTGATTGCAACATCCTGG - Intergenic
1176536816 21:8109460-8109482 GTCTGCTGATTGCAACATCCTGG + Intergenic
1178571814 21:33745251-33745273 TTTTGCTGATTGCATTCTCATGG - Intronic
1183097689 22:35563138-35563160 TTATGCTTATTGAAATTTCCTGG - Intergenic
1203241764 22_KI270733v1_random:25866-25888 GTCTGCTGATTGCAACATCCTGG + Intergenic
950818190 3:15729713-15729735 TTATGCGTCTTGCAGTATCTTGG - Intronic
953233888 3:41089041-41089063 TTATACTGATTACAGTGTACTGG - Intergenic
960745108 3:120878921-120878943 TGCTGCTGATTGCAGTATAGTGG - Intergenic
961112362 3:124295936-124295958 TTGTGCTGTGTGCACTATCCTGG - Intronic
962877698 3:139548428-139548450 TTGTGCTGATTGTAGAATCCTGG + Intergenic
965164536 3:165179282-165179304 TTATGCTGATTTGAGTATGTTGG - Intergenic
967897087 3:194405876-194405898 TATTGCTGATAGCAGTATTCAGG - Exonic
970183744 4:13427696-13427718 TTTTTCTGATTGCAGCTTCCTGG - Intronic
971368633 4:25997231-25997253 TTTTGCTGATTGCATTACCCAGG - Intergenic
975069099 4:70110629-70110651 ACACGCTGATTGCAGAATCCTGG - Intergenic
976726905 4:88223706-88223728 TCATGATGATTACAGCATCCTGG + Intronic
977900104 4:102412558-102412580 TTATGCTAAGTGCAGTATGCTGG + Intronic
979135640 4:117109317-117109339 TTATGCAGATTACAGTTTACAGG - Intergenic
979932046 4:126643040-126643062 TTATTGTAATTGCAGTCTCCTGG - Intergenic
982921861 4:161285651-161285673 TTTTGCTGCTTGCACAATCCTGG - Intergenic
983000042 4:162402926-162402948 TCATGCGGAATGCAGAATCCGGG + Intergenic
984978165 4:185249906-185249928 TTATGCTAATTCCAACATCCGGG + Intronic
985276774 4:188245184-188245206 CAATGCTCATTGCAGGATCCTGG - Intergenic
990012735 5:51020065-51020087 TTATGCTAATTGAAATTTCCTGG + Intergenic
992149560 5:73889611-73889633 TTGTGCTGATTCTATTATCCAGG - Intronic
994391604 5:99198152-99198174 TGATGTTGATTGTAATATCCAGG - Intergenic
995583841 5:113626207-113626229 TTATACAGATTACAGTATCAAGG - Intergenic
995983476 5:118138205-118138227 TTTTGCAGATTTCAGTATGCAGG + Intergenic
1000630717 5:163587488-163587510 TTATTCTCATTGCAGATTCCTGG - Intergenic
1002375658 5:178787326-178787348 TTACGCTGATACCAGTATGCAGG + Intergenic
1003664392 6:8096538-8096560 TTATTCTGATTGTTATATCCTGG - Intronic
1007559600 6:42796115-42796137 TTTTGCTCACTGCAGCATCCTGG - Intronic
1009367580 6:62867742-62867764 TTATGTTGTTTGTAATATCCAGG - Intergenic
1009839989 6:69057915-69057937 TTTGTCTGATTTCAGTATCCAGG + Intronic
1010560682 6:77345217-77345239 TTATGTTGATTCCATTATCCTGG - Intergenic
1016214560 6:141581684-141581706 TTATTTTGACAGCAGTATCCAGG + Intergenic
1020877570 7:13717258-13717280 TTAAGAGGATTGCAGCATCCAGG + Intergenic
1022612594 7:31891883-31891905 TTATGCTAATATCAGTATCTTGG + Intronic
1022763533 7:33383229-33383251 TTATGCTGATTGCAGTATCCAGG + Intronic
1034510463 7:151530312-151530334 TTATGCTGTTTGAGGTTTCCCGG + Intergenic
1036013141 8:4750805-4750827 TTATGCTTGTTTCAGTATCAAGG + Intronic
1036991505 8:13602157-13602179 TTTTGCTGATTGCAATACCATGG - Intergenic
1038637360 8:29298760-29298782 TGATATTGATTGCAATATCCAGG + Intergenic
1039150534 8:34500151-34500173 TTTTGCTGATTTCAGAAACCTGG + Intergenic
1039431981 8:37532010-37532032 TCATGCTGATGACAGGATCCAGG - Intergenic
1039501499 8:38021400-38021422 TCAAGCTGATCGCAATATCCTGG + Intergenic
1044167113 8:88999932-88999954 TTATCCAGATGGCTGTATCCTGG - Intergenic
1044497756 8:92909295-92909317 TTATGCTGATGGTAATCTCCTGG - Intronic
1045924146 8:107567152-107567174 TGATGTTGTTTGCAATATCCAGG + Intergenic
1048929456 8:139300425-139300447 TTATGCTGAGTGAAGTAAGCTGG - Intergenic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1055553756 9:77455132-77455154 TCAGGCTGATGGCAGGATCCAGG + Intronic
1056277779 9:85010263-85010285 TTATGATGATGGCATTATGCTGG - Intronic
1203458086 Un_GL000220v1:8942-8964 GTCTGCTGATTGCAACATCCTGG + Intergenic
1188253436 X:27928628-27928650 TTATGCTGATTGCAACTTCCTGG + Intergenic
1190846384 X:54195719-54195741 CCATGCTGACTGCAGTAACCGGG - Exonic
1195940151 X:110161239-110161261 TCATGCTGACATCAGTATCCAGG + Intronic
1198541152 X:137641219-137641241 TTATGCTGATTGCAGTGGCTTGG - Intergenic
1199326258 X:146502138-146502160 TTATGCTAACTTCAGTGTCCTGG + Intergenic
1199333790 X:146594440-146594462 TTATGCTAAGTGCATAATCCAGG - Intergenic