ID: 1022768164

View in Genome Browser
Species Human (GRCh38)
Location 7:33439097-33439119
Sequence CTAAAGCCTGGGGCCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022768155_1022768164 14 Left 1022768155 7:33439060-33439082 CCTGTATTCTTGGTCAAGCTTTA 0: 1
1: 0
2: 2
3: 5
4: 101
Right 1022768164 7:33439097-33439119 CTAAAGCCTGGGGCCAGCTCAGG No data
1022768154_1022768164 23 Left 1022768154 7:33439051-33439073 CCAAAAATGCCTGTATTCTTGGT 0: 1
1: 0
2: 1
3: 22
4: 279
Right 1022768164 7:33439097-33439119 CTAAAGCCTGGGGCCAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022768164 Original CRISPR CTAAAGCCTGGGGCCAGCTC AGG Intronic
No off target data available for this crispr