ID: 1022769945

View in Genome Browser
Species Human (GRCh38)
Location 7:33459086-33459108
Sequence CTCTTCAGTAATTGGCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022769945 Original CRISPR CTCTTCAGTAATTGGCAATA AGG (reversed) Intronic
901763661 1:11486798-11486820 CTCCTGAGTAATTGGGACTACGG + Intronic
904977058 1:34464774-34464796 CTCGCCAGTCAATGGCAATAAGG + Intergenic
906271277 1:44480969-44480991 GTCTTCAGGATTTGGCAATATGG + Intronic
906843318 1:49163069-49163091 CTCTTCAGCAATTGGTAAATAGG + Intronic
906855524 1:49300332-49300354 CTGTTCATTAATTGGTAAAATGG + Intronic
908192282 1:61715523-61715545 CTCTTCAGTAGCTGGGACTACGG - Intronic
908567868 1:65377174-65377196 ATATTCAGTAAATGTCAATAAGG + Intronic
909840894 1:80321824-80321846 CTCTTCAGTAGCTGGGATTACGG - Intergenic
909896197 1:81072569-81072591 TGCTTCAGTGATTGGCAAGAAGG - Intergenic
913700375 1:121368517-121368539 CTCTTCAGTACTAGGCAAAGAGG - Intronic
914040927 1:144048975-144048997 CTCTTCAGTACTAGGCAAAGAGG - Intergenic
914137163 1:144911501-144911523 CTCTTCAGTACTAGGCAAAGAGG + Intronic
915434867 1:155896652-155896674 CTCTTCAGTAGCTGGGACTACGG - Intergenic
917099044 1:171427449-171427471 CTCCTCAGTTGTTGGAAATATGG - Intergenic
920487791 1:206387244-206387266 CTCTTCAGTACTAGGCAAAGAGG - Intronic
920563515 1:206956226-206956248 CTCTTCAGTAAAGGGCCACATGG - Intergenic
924515694 1:244763815-244763837 CTCCTGAGTAATTGGGACTACGG + Intergenic
1064479233 10:15722672-15722694 CCCTTCAGTAATTTTCAATGAGG + Intergenic
1066063223 10:31742772-31742794 CTCTTCATTAATTAGTCATAGGG - Intergenic
1069185948 10:65423119-65423141 CTCTTGAGAAATTGAGAATAAGG + Intergenic
1071109930 10:82143905-82143927 CTCTTGAGTAACTGGGACTACGG - Intronic
1072994075 10:100228008-100228030 CTCCTCATTAATTGGCCTTAAGG - Intronic
1074682949 10:115927992-115928014 CTCTTCAGAATTTGGCTCTATGG + Intronic
1075243218 10:120797823-120797845 CTGTTCAGTAAATGCCAATTGGG - Intergenic
1079812858 11:25016947-25016969 CTTTTTAGTAATGGGCATTATGG + Intronic
1079909082 11:26286691-26286713 CCACTCAGTAATTGGCAATGCGG + Intergenic
1080582375 11:33654641-33654663 CTCTTCATCAACTGTCAATATGG + Intronic
1087164156 11:94983778-94983800 CTTTTCAGTTGTTGGCAATTTGG - Intronic
1087212892 11:95461431-95461453 ATCTTCTGTAACTGGCCATAGGG + Intergenic
1089479526 11:118792816-118792838 CTCTTCAGTAATCGGCCAGAAGG + Intergenic
1090123007 11:124053188-124053210 CTCTTCCCTAATGGGCACTAAGG - Intergenic
1093814398 12:23527281-23527303 ATCTTTAGAAACTGGCAATAAGG + Intergenic
1095512466 12:42967502-42967524 GGCTCCAGTAAATGGCAATATGG + Intergenic
1095683607 12:45006753-45006775 CTCTTCTTTAACTGGCAATGGGG + Intergenic
1097618595 12:61913080-61913102 CTCTACAATAATTGCCAATGGGG + Intronic
1099606598 12:84809826-84809848 CTCTTTTGTTATTGGCAGTAGGG + Intergenic
1100891718 12:99132999-99133021 CTCTTAAGTATATGGCAACATGG + Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103637126 12:122316331-122316353 CTCCTGAGTAATTGGCAAATAGG + Intronic
1105765923 13:23559441-23559463 CTCTCCAGTATTTGCCAGTAAGG + Intergenic
1108235532 13:48399985-48400007 TTGTTCATTAATTGGCAAAAGGG + Intronic
1109331107 13:60931546-60931568 CTATTAAATAATTGACAATATGG + Intergenic
1109704778 13:66076141-66076163 CTCTTTAGCAAATGTCAATAAGG - Intergenic
1109896887 13:68703945-68703967 CTCTTCAGTAAATTGCATTAAGG + Intergenic
1111901080 13:94200424-94200446 CTCCACAGCCATTGGCAATAGGG - Intronic
1112264415 13:97909867-97909889 CTATTCAATAAATGGCACTAGGG - Intergenic
1112625591 13:101100012-101100034 TTCTTCAGTCATTGGTTATAAGG - Intronic
1114852595 14:26399188-26399210 ATCTTCAGGAATTGGGGATATGG - Intergenic
1115052355 14:29078773-29078795 CTCAGCAGTAATTGGCAAATAGG + Intergenic
1115383170 14:32763339-32763361 CTTTTCCATAATTAGCAATAAGG + Intronic
1120224934 14:81780013-81780035 ATGGTAAGTAATTGGCAATAGGG + Intergenic
1120256421 14:82125219-82125241 CTCTTCAGTAACTGACAGTTAGG + Intergenic
1120502918 14:85319297-85319319 CTTTTCAGTTATTGCCAAGAAGG - Intergenic
1121621289 14:95350557-95350579 CTCTTCAGTTATTGCCATTTTGG + Intergenic
1121875956 14:97453504-97453526 CTCTTCATTATTTGGCAATGAGG + Intergenic
1124052096 15:26206442-26206464 TTCTTCAGTAATTGACAGGATGG - Intergenic
1125026944 15:35040345-35040367 CACTTAAGTAATTGGAAATTGGG + Intergenic
1126418170 15:48440857-48440879 CTCTTCCATATTTGGTAATACGG + Intronic
1126508552 15:49438447-49438469 CTCTTCTGCAATTGACAATCTGG - Intronic
1135246244 16:20859798-20859820 ATCTTCAGTAATTTCCAAAATGG + Exonic
1135258507 16:20961236-20961258 CTGTTCAGTAGTTGGAGATAGGG + Intronic
1136106690 16:28035127-28035149 CTCTTGAGTAACTGGGACTATGG + Intronic
1137373709 16:47932643-47932665 CTCCTCAGAAATTGGCAGTTGGG + Intergenic
1138405605 16:56790638-56790660 TTGTTCAGAAATTGGCAAGAAGG + Intronic
1139354208 16:66357621-66357643 CTCTTCTGGACTTGGCAAGACGG - Intergenic
1139965938 16:70745422-70745444 CTCTGCTGCAATGGGCAATAGGG + Intronic
1141350892 16:83295138-83295160 CTCTTCAATAAATGGCATTTGGG + Intronic
1143961787 17:10727264-10727286 CTCTTGAGTAACTGGGACTACGG + Intronic
1145275912 17:21430343-21430365 GTCTGCAGCATTTGGCAATATGG - Intergenic
1145313759 17:21716256-21716278 ATCTGCAGCATTTGGCAATATGG - Intergenic
1145712200 17:26988230-26988252 GTCTGCAGCATTTGGCAATATGG - Intergenic
1149508236 17:57213756-57213778 CTCCTGAGTAATTGGGATTATGG + Intergenic
1150773404 17:68060436-68060458 CTCTTCAGTAAGTGGCACCATGG - Intergenic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1153416179 18:4848406-4848428 TTCAACAGTATTTGGCAATAGGG - Intergenic
1155429281 18:25738446-25738468 TTCTTTACTAATTGGCTATAGGG - Intergenic
1156352102 18:36310562-36310584 CTCCTGAGTAATTGGAATTACGG - Intronic
1157207385 18:45712126-45712148 CTCTAAAGTAATTGGAAATCAGG - Intergenic
1159565499 18:70043362-70043384 CTATTCTCTAATTGGCATTATGG + Intronic
1162637678 19:11983141-11983163 CTGTTCAGTGATTTGGAATATGG + Intergenic
1162653554 19:12110491-12110513 CTGTTGAGTAATTTGGAATATGG + Intronic
1162673177 19:12275871-12275893 CTGTTCAGTGATTTGAAATATGG - Intronic
1163726717 19:18927261-18927283 CTCTTGAGTAGTTGGAACTACGG - Intronic
928579401 2:32691658-32691680 CTCTTCAGCAATTGTTGATAAGG - Intronic
928769918 2:34694470-34694492 CTCTTCTGTAATGGGCCATGGGG + Intergenic
930948936 2:57113185-57113207 TTTTTCAGGAATTGACAATAGGG - Intergenic
931593054 2:63907393-63907415 CTCTTGAGTAACTGGGATTACGG - Intronic
931605643 2:64049637-64049659 CTCTTCAGCAATTAGCAACAAGG - Intergenic
931611071 2:64101747-64101769 CTCTTCTATATTTGGAAATAGGG - Intronic
931636953 2:64349462-64349484 CTCCTCAGTCATGGGCATTAAGG + Intergenic
936335132 2:111582538-111582560 CTCTCCAGCCATTTGCAATAGGG + Intergenic
940603270 2:155887586-155887608 CTCTTCAATAAATGGTACTAGGG + Intergenic
941939670 2:171020916-171020938 CACTTTAGTAATTGGGGATAGGG - Intronic
943189225 2:184654424-184654446 CTCTGCAGCAATCAGCAATATGG - Intronic
945170387 2:206989302-206989324 CTCTTCAGGAAATGGCTGTACGG + Intergenic
947790513 2:232864842-232864864 CTCTTGAGTAGTTGGGACTATGG + Intronic
948972249 2:241438295-241438317 CTCTTGAGTAGTTGGGATTAAGG - Intronic
1169358891 20:4930862-4930884 CTCTTGAGTAGTTGGTATTATGG - Intronic
1170139696 20:13113058-13113080 CTCCTCAGTAACTGGGATTATGG - Intronic
1170777110 20:19385370-19385392 CTCTTCAATAAATGGCATTAGGG - Intronic
1175209886 20:57347272-57347294 CTCTCCAGTAACTGGGATTACGG - Intergenic
1175560881 20:59929222-59929244 CTCTTTAGTTTTTGCCAATATGG - Intronic
1176949260 21:15024923-15024945 CTTTTCTGTGATTGACAATAAGG - Intronic
1177513461 21:22119927-22119949 CTCTTCAGTAGCTGGGACTATGG - Intergenic
1178829149 21:36040707-36040729 CTCTTCAGTCATTTGCTATGAGG - Intronic
1179774753 21:43654313-43654335 CTCTGCAGTAGCTGGAAATAGGG - Intronic
1181936050 22:26439661-26439683 GTCTTCAGTTATTGGTAACAAGG + Intronic
1182947555 22:34338628-34338650 CTCTTCATTAACTGGGGATAGGG - Intergenic
1183099173 22:35573249-35573271 CTTTTCAGTAAATGCTAATAAGG + Intergenic
949150174 3:757430-757452 CTCTCCAGTAATCGCCAACATGG - Intergenic
949767607 3:7544283-7544305 CTCTTGAGTAATTGGAACTATGG + Intronic
956103107 3:65789056-65789078 CTCCTCAGTAACTGGGACTACGG - Intronic
959818269 3:110702082-110702104 CTCTTCAATAAATGGCACTGGGG - Intergenic
960049554 3:113226865-113226887 CTCTTCAGTCAATTGCCATAGGG + Intronic
961143495 3:124575106-124575128 CTGTTCAGTAACTGCCCATAGGG - Intronic
962063842 3:131958779-131958801 CTCTTGAGTAACTGGGATTATGG + Intronic
965957933 3:174393826-174393848 TTCTTAAGTACTTGGCAATTAGG - Intergenic
970329964 4:14970904-14970926 CTCTTCAGTAAATGGTGCTAGGG + Intergenic
971651456 4:29280916-29280938 CTCTGCAATAACTGGTAATATGG - Intergenic
972389192 4:38597125-38597147 CTCTACAGTATATGCCAATACGG + Intergenic
972460190 4:39294545-39294567 CTCTTGAGTAGTTGGGACTAAGG - Intronic
978350107 4:107812427-107812449 CTCTACAGTAAGGGCCAATAAGG - Intergenic
979783251 4:124682381-124682403 CTGTTCTGTAATTGACAATTAGG + Intronic
980338567 4:131509609-131509631 CTCTTCAGTGCTTTGCAATAGGG + Intergenic
982742844 4:159075816-159075838 CTCTTCAGTATTTTGTAATGAGG + Intergenic
984315801 4:178129588-178129610 CTCCTCAGTAGCTGGGAATATGG - Intergenic
984724678 4:183009438-183009460 CTCTCCTGTAATTGGCACCAAGG - Intergenic
984847985 4:184123809-184123831 CTAATCAGTATTTGGCAAAAAGG - Intronic
986218762 5:5747243-5747265 CACTTCAAGAAGTGGCAATAAGG - Intergenic
988292930 5:29314237-29314259 CTCATTACTAATTGGCAATTTGG - Intergenic
988951227 5:36263215-36263237 CTTTTCAATAACTGGAAATAAGG + Intronic
989632494 5:43500123-43500145 CTTTTTAGTTATTGGCAATTTGG + Intronic
993318911 5:86447256-86447278 CTACTCAGTCAATGGCAATAAGG + Intergenic
993874510 5:93291150-93291172 CTCTACAGTAGTTAGCAATATGG + Intergenic
994420025 5:99520202-99520224 CTCCTCAGTAGTTGGGACTAAGG + Intergenic
994422567 5:99539477-99539499 GTGTTCAGTAATTGCTAATAAGG - Intergenic
994459806 5:100058026-100058048 GTGTTCAGTAATTGCTAATAAGG + Intergenic
994487184 5:100394937-100394959 CTCCTCAGTAGTTGGGACTAAGG - Intergenic
994787503 5:104182842-104182864 CTTTTTGGTAATTGGGAATAAGG + Intergenic
995461212 5:112405186-112405208 CTCCTGAGTACTTTGCAATATGG - Intronic
995586292 5:113652227-113652249 CTCTTCAGAAATTGGAAAGGTGG - Intergenic
995974294 5:118012531-118012553 CTATTCAGGAATGGGCAAAAAGG - Intergenic
997991402 5:138547164-138547186 CTCCTCAGTAGCTGGCACTAGGG - Intergenic
999666394 5:153917334-153917356 CTAGCCAGTCATTGGCAATAGGG - Intergenic
1006664628 6:35683586-35683608 CTCTTGAGTAGTTGGGACTAAGG + Intronic
1007579587 6:42949362-42949384 CTCTTGAGTAGTTGCCATTATGG - Intergenic
1010711459 6:79180139-79180161 CTCTTCTGTAATTTGAAACAGGG - Intergenic
1011771643 6:90679878-90679900 CTCTTCTGTATTTGGAGATAAGG - Intergenic
1012431825 6:99172038-99172060 CTTTTCAGTAATTGGGCAGAAGG + Intergenic
1014063694 6:117101587-117101609 CTCTTGAGTAGTTGGGACTACGG + Intergenic
1015789728 6:136954623-136954645 CTCTTCAGTAGCTGGGACTAAGG + Intergenic
1016196354 6:141347277-141347299 CTCTTAAGAATATGGCAATAAGG + Intergenic
1017172459 6:151470757-151470779 CTCTTCAGTAGCTGAAAATATGG + Intergenic
1018214233 6:161511454-161511476 CTCCTGGGGAATTGGCAATAAGG + Intronic
1019879294 7:3844290-3844312 CCTTTAAATAATTGGCAATACGG - Intronic
1021713563 7:23440311-23440333 CTCTGCAGTAACTGGGATTAAGG - Intronic
1022515449 7:30972208-30972230 CTGTTCTGTAATTGGCCATGCGG - Intronic
1022769945 7:33459086-33459108 CTCTTCAGTAATTGGCAATAAGG - Intronic
1024839745 7:53572213-53572235 TTCTTTAATAATTGGCAATTTGG - Intergenic
1024961011 7:54976435-54976457 CTTTTCAGTAAGTGGTACTAGGG + Intergenic
1026230861 7:68482774-68482796 ATGCTCAGTAATTGGCAAAATGG + Intergenic
1027530997 7:79332486-79332508 CTATTCAGAAAAGGGCAATAAGG - Intronic
1027877402 7:83788116-83788138 CTTTTCAGTAAATCACAATATGG + Intergenic
1027942116 7:84695716-84695738 CTCTTCAATAAATGGCACTGGGG - Intergenic
1030003574 7:105092842-105092864 CTCTTCTGTAACTGGCTTTAAGG + Intronic
1032886196 7:136141621-136141643 CACTTGAATCATTGGCAATATGG + Intergenic
1033918355 7:146356372-146356394 CTATTAATTAATGGGCAATAAGG - Intronic
1037782364 8:21879105-21879127 CTCCTCAGTAACTGGGATTATGG - Intergenic
1042178248 8:66058867-66058889 CTCTTCACAAAATGTCAATAAGG - Intronic
1043386745 8:79756621-79756643 CTCTCCAGTAACTGGGACTACGG + Intergenic
1046477267 8:114762043-114762065 CTCTAAAGTAATAGGCGATAAGG - Intergenic
1047389055 8:124435124-124435146 CTCTTCATTAATCGGCACTGGGG + Intergenic
1047790770 8:128201285-128201307 CTCTTCACTCTTTGGCAAAAGGG - Intergenic
1050717140 9:8542701-8542723 TCCTTCAGGAATTGGCAAAAGGG + Intronic
1051323538 9:15938047-15938069 CTCTTCAGTATCTGGCAATCAGG - Intronic
1055450886 9:76430502-76430524 CTCCTCAGTAACTGGGACTAAGG + Intronic
1058941667 9:109818702-109818724 CTCTTGAGTAGTTGGGACTACGG + Intronic
1059213267 9:112534664-112534686 CTCTTGAGTAACTGGGATTATGG + Intronic
1059314552 9:113412809-113412831 CTTTTCATTCATTGGCCATATGG - Intronic
1059524408 9:114977036-114977058 GTCTTCAGTAATTGCCCATCTGG + Intergenic
1187123289 X:16429934-16429956 CTCTATAGTAAATGGCAAGAAGG - Intergenic
1187181706 X:16948673-16948695 CTCTTTAGGAATTGGGAAGAAGG + Intronic
1190853888 X:54273997-54274019 CTCTACAGTAACTGGCAGCAAGG + Intronic
1195753225 X:108177546-108177568 TTCTACAGTACTTGGCACTAGGG - Intronic
1196732940 X:118959617-118959639 TTCTTTAGAAATTGGCAAGATGG + Intergenic
1198808077 X:140508579-140508601 CTCTTCAGTAACTGCTCATAGGG + Intergenic
1201451105 Y:14116082-14116104 CTCTTCTGTAAGGAGCAATATGG + Intergenic