ID: 1022772225

View in Genome Browser
Species Human (GRCh38)
Location 7:33486031-33486053
Sequence TGTTGGCGGTGTGGGAGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 399}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022772217_1022772225 18 Left 1022772217 7:33485990-33486012 CCTGATTTCCTAACTTTGGAAAT 0: 1
1: 0
2: 0
3: 25
4: 294
Right 1022772225 7:33486031-33486053 TGTTGGCGGTGTGGGAGTAGGGG 0: 1
1: 0
2: 2
3: 30
4: 399
1022772218_1022772225 10 Left 1022772218 7:33485998-33486020 CCTAACTTTGGAAATTAATCTTT 0: 1
1: 0
2: 3
3: 45
4: 455
Right 1022772225 7:33486031-33486053 TGTTGGCGGTGTGGGAGTAGGGG 0: 1
1: 0
2: 2
3: 30
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022772225 Original CRISPR TGTTGGCGGTGTGGGAGTAG GGG Intronic
900716019 1:4144582-4144604 TGGTGGTGGTGTGGTAGTGGTGG - Intergenic
902306476 1:15543448-15543470 TGTTGGAGGAGTGGAAGAAGAGG + Intronic
903778239 1:25806585-25806607 TGTAGGCGGGGAGGGAGTAGGGG + Intronic
903969155 1:27107792-27107814 TGATGGTGGTGTGGGACTTGTGG + Exonic
904196506 1:28789766-28789788 TGTTGGAGCAGGGGGAGTAGTGG - Intergenic
904554141 1:31346961-31346983 TGTGGGTGGGGTGGGAGGAGTGG - Intronic
904649092 1:31990789-31990811 TGTTGGGGGTGTAGGGGTGGTGG + Intergenic
904799538 1:33082596-33082618 TGTGGGCGGTGAGGGAGAGGGGG - Intronic
904831147 1:33307523-33307545 TGAGGGTGGGGTGGGAGTAGAGG - Intronic
905690992 1:39942670-39942692 TGGTGGTAGTGTGAGAGTAGAGG - Intergenic
905692053 1:39950729-39950751 TGATGGTGGTGTGACAGTAGAGG - Intergenic
906010003 1:42514036-42514058 TGTTGGAGGTGGGGCATTAGTGG - Intronic
906460914 1:46034715-46034737 TGTTGGGGGTGGGGGAGAAGGGG - Exonic
910210552 1:84788582-84788604 TGTTGGGGATGGGGGATTAGGGG - Intergenic
910396023 1:86794536-86794558 TTTTGGCGGGGTGGGGGTGGGGG - Intergenic
910542281 1:88373665-88373687 TGTAGGCAATGTGGGAGTACTGG - Intergenic
911075448 1:93868847-93868869 TGTTGTGGGTGGGGGACTAGGGG + Exonic
911127196 1:94351646-94351668 TGTGGGAGGTGTGGGAGCTGGGG - Intergenic
911724854 1:101232556-101232578 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
911746969 1:101451058-101451080 TGTTGTGGGGTTGGGAGTAGGGG + Intergenic
912170022 1:107088262-107088284 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
912260763 1:108109927-108109949 TGCTGGTGGTGGGGGAGGAGGGG - Intergenic
912432576 1:109636808-109636830 TGGTGGCAGTGTGGGTGGAGAGG + Intergenic
913406907 1:118504366-118504388 TGTGGGAGATGGGGGAGTAGGGG + Intergenic
913410215 1:118542724-118542746 TGATGGGGGTGTGGGACCAGCGG - Intergenic
913529180 1:119721337-119721359 TGCGGGCGGTTTGGGGGTAGGGG + Intronic
916483599 1:165236977-165236999 TGTAGGCTGTGTGAGAGCAGAGG + Intronic
916941912 1:169685777-169685799 TGTTGCCAGGGAGGGAGTAGAGG - Intronic
920427232 1:205888114-205888136 AGTTGCCAGTGAGGGAGTAGAGG + Intergenic
920994059 1:210970260-210970282 TGTTGGGGGTGGGGGACAAGGGG - Intronic
921327174 1:213997732-213997754 GGTTGGCGGTGTGGAAATTGTGG - Exonic
921448792 1:215278419-215278441 TGGTGGGAGTGTGGGAGTAGGGG + Intergenic
921728910 1:218554856-218554878 TGTTGGGGGTGAGGGGTTAGGGG - Intergenic
921961929 1:221044791-221044813 TTTTGGGGGTGTGGGGGAAGTGG - Intergenic
923975855 1:239261541-239261563 TGTTGGGGGTGAGGGTGGAGAGG + Intergenic
1063055201 10:2496975-2496997 TGTTGGAGTTGTGGGCTTAGAGG + Intergenic
1063678178 10:8160525-8160547 TGTTGGAGGTGTTGGAGATGGGG - Intergenic
1063765375 10:9134242-9134264 TGTCGGGGGTGAGGGACTAGGGG - Intergenic
1064348219 10:14552446-14552468 TGTTGGGTGTGTGTGGGTAGTGG - Intronic
1065394703 10:25222204-25222226 AGTTGGGAGTGTGGGAGTACAGG - Intronic
1065793109 10:29279671-29279693 TTTTGGCTGTGTGAGAGTTGAGG + Intergenic
1066033643 10:31456252-31456274 TGTTGGCGGGGTGGGGGTCTAGG + Intronic
1067581362 10:47448337-47448359 TGGTGGCTGTGTGCGTGTAGAGG + Intergenic
1069614986 10:69801395-69801417 GGTTGGGGGCTTGGGAGTAGAGG + Intergenic
1070410372 10:76134006-76134028 TGTTGGGGGTGGGGGAGGTGAGG - Intronic
1071578859 10:86752443-86752465 TGTGGGCTGCGTGGGAGTTGGGG + Intergenic
1071662451 10:87518481-87518503 TGATGGTGGTGTGAGAGTAAAGG - Intronic
1071711852 10:88057587-88057609 TGTTGGCAGTGTGGATGGAGAGG + Intergenic
1071880163 10:89888637-89888659 TGTGGGGGGTGGGGGGGTAGGGG - Intergenic
1072161757 10:92773744-92773766 TGTTGGAGGTAGGGGAGTGGAGG - Intergenic
1073365402 10:102936015-102936037 TTTTGGTGCTGTGGGGGTAGGGG + Intronic
1073828870 10:107358944-107358966 TGTTGGCTGACTGGGAATAGTGG - Intergenic
1074480396 10:113815065-113815087 TGTTGGGGGAGTGGGGGTTGAGG + Intergenic
1074737808 10:116453931-116453953 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1074889582 10:117724206-117724228 TGTTGGGGGTGTGGGGTCAGGGG + Intergenic
1075944446 10:126420035-126420057 TGTTGAGGGGGTGGGAGGAGGGG + Intergenic
1077156570 11:1094685-1094707 TGTTGGAGGGCTGGGAGTGGTGG - Intergenic
1077156602 11:1094802-1094824 TGTTGGAGGGCTGGGAGTGGTGG - Intergenic
1077156648 11:1094967-1094989 TGTTGGAGGGCTGGGAGTGGTGG - Intergenic
1077156655 11:1094991-1095013 TGTTGGAGGACTGGGAGTGGTGG - Intergenic
1077156668 11:1095039-1095061 TGTTGGAGGGCTGGGAGTGGTGG - Intergenic
1077615770 11:3672363-3672385 TGTGGGCAGTGTGGGAGAAGAGG + Intronic
1077776378 11:5276409-5276431 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1078998918 11:16733573-16733595 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1079028664 11:16968711-16968733 TGTTGGTGGTGGGGGAGTCATGG - Intronic
1079858982 11:25643635-25643657 TTCTGGTGGTGTGAGAGTAGAGG + Intergenic
1080383725 11:31798545-31798567 AGTTGCCGGCGTGGGGGTAGCGG - Intronic
1080670716 11:34374133-34374155 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1081670382 11:44939062-44939084 TGCTGGCGGTGGGGGAGTGGGGG - Intronic
1084275497 11:68049249-68049271 TGCTGGGGCTGTGGGAGAAGAGG - Exonic
1084770156 11:71337502-71337524 TGTTGGAGGTGTGGGCCTGGTGG + Intergenic
1085024186 11:73227074-73227096 TGTTGGGGTTGTGGGGCTAGGGG - Intronic
1085265137 11:75233154-75233176 TGTTGGTGGTGGGAGAGTGGGGG - Intergenic
1086226197 11:84512982-84513004 TGTTGGGGTTGGGGGACTAGGGG + Intronic
1087250517 11:95893717-95893739 TGATAGCTGTGTGGGAGAAGAGG - Intronic
1089216001 11:116835152-116835174 TCTGGGCGGGATGGGAGTAGTGG + Intergenic
1090136498 11:124204484-124204506 TGCTGGGGGTGGGGGAGGAGTGG + Intergenic
1090412646 11:126519792-126519814 TGTGGGGGTTGTGGGAGGAGAGG - Intronic
1090868856 11:130725488-130725510 TGTTGGTGCTTTGGGAGTTGGGG + Intergenic
1092236554 12:6814350-6814372 TGGTGCAGGGGTGGGAGTAGTGG - Intronic
1093924057 12:24891033-24891055 TTGTGGTGGTGTGAGAGTAGAGG + Intronic
1094448406 12:30558597-30558619 TGGTGGCGGGTTGGGAGTGGCGG + Intergenic
1095963441 12:47850642-47850664 TGGTGGCGTGGTGGGAGTAGAGG + Intronic
1096320405 12:50607137-50607159 TGTTGGTGGAGTGGGTGGAGAGG + Intronic
1096672589 12:53209152-53209174 AGTTGAGGATGTGGGAGTAGGGG - Intergenic
1096795039 12:54071468-54071490 GGTGGGGGGTGGGGGAGTAGGGG + Intergenic
1096943418 12:55375721-55375743 TGTCGGGGGTGTGGGGCTAGGGG - Intergenic
1097584169 12:61495286-61495308 TGTCGGGGGTGGGGGACTAGGGG - Intergenic
1099404507 12:82244169-82244191 TGTTGGGGGTTGGGGACTAGAGG - Intronic
1101142467 12:101810641-101810663 TGTAGGCTCTGTGGGAGCAGGGG - Intronic
1101826649 12:108225569-108225591 TGGTGGAGGTGTGTGAGCAGAGG + Intronic
1102620804 12:114193162-114193184 TGTTGGGGGTATGGGTGTAGTGG - Intergenic
1103576791 12:121883430-121883452 AGGTGGCGGGGTAGGAGTAGAGG + Intergenic
1104463692 12:128973884-128973906 TGTAGGGGGTGTGTGTGTAGGGG + Intronic
1104686511 12:130788419-130788441 TGTGTGCGGTGTGGGAGGGGTGG - Intergenic
1104953903 12:132454557-132454579 TGTTGGGGGTGAGGGGGCAGTGG + Intergenic
1105304927 13:19161595-19161617 TGGAGGAGGTGGGGGAGTAGGGG + Intergenic
1105351416 13:19619672-19619694 TGGTGGTGGGGTGGGGGTAGAGG - Intergenic
1105989447 13:25603603-25603625 TGATGGGGGTGTTGGAGTGGAGG + Intronic
1106411887 13:29516386-29516408 TGTGTGGGGTGTGGGAGTGGGGG - Intronic
1106577856 13:30992610-30992632 TGGTGGAAGTGTGGGAGGAGGGG + Intergenic
1107600083 13:42004320-42004342 TATTGGCTGTGTGGGAGTGGAGG - Intergenic
1107995338 13:45853979-45854001 TGGTGCAGGTGTGGGGGTAGGGG - Intergenic
1109472500 13:62827669-62827691 TATTGACGGTGTGGCACTAGTGG - Intergenic
1110136033 13:72068237-72068259 TGTTGGGGGTTGGGGACTAGTGG + Intergenic
1111711680 13:91823252-91823274 TATTGGCAGTTTGGGGGTAGTGG - Intronic
1111788001 13:92815710-92815732 GGGTGGGGGTGTGGGAATAGTGG + Intronic
1112684091 13:101802902-101802924 TGTTGAGGCTGTGGGAGAAGAGG + Intronic
1113046714 13:106164051-106164073 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1113413269 13:110108636-110108658 TGTTGGGTGTGTGTGAGTATGGG + Intergenic
1114757819 14:25280310-25280332 TGTTGGCGAGGTGGGGGTTGTGG - Intergenic
1116554272 14:46283782-46283804 TGTTGGGGGTGGGGGGGTGGGGG - Intergenic
1116725275 14:48554788-48554810 TGCTGGGGGTGTGGGAGGGGTGG + Intergenic
1116914942 14:50515563-50515585 TGATGCCAGTGTGGGATTAGTGG - Intronic
1119831665 14:77708214-77708236 TGATGGAGATGTGGGAGTAGTGG + Intronic
1120513065 14:85438654-85438676 TTTTGGTGGTGTGAGAGCAGAGG + Intergenic
1120987080 14:90343760-90343782 TGGGGGCGGTGTGGGGGGAGTGG + Intergenic
1121468312 14:94129829-94129851 TATTGGCGGGGTTGGAGTGGGGG - Intronic
1122186876 14:100006013-100006035 TGTTGTCGGTGTGGGGGGGGGGG - Intronic
1123131869 14:105993931-105993953 TGTTGGAGGTGTGGCAGCTGTGG + Intergenic
1123448206 15:20344700-20344722 TGTTGCCACTGTTGGAGTAGCGG + Intergenic
1123450566 15:20357078-20357100 TGATGGGGGTGGGGGAGGAGGGG + Intergenic
1123680951 15:22763121-22763143 TGTTGGCTGGGTGGGTGTGGTGG - Intergenic
1124893094 15:33750867-33750889 TGTGGGGGTTGTGGGGGTAGGGG - Intronic
1126476918 15:49074934-49074956 TGTGGGAGGTGAGGGGGTAGGGG + Intergenic
1127709918 15:61586619-61586641 TGTTGGAGGTGGGGGGCTAGGGG + Intergenic
1127890129 15:63242861-63242883 TGGTGGTGGTGTGGGGGTGGGGG + Intronic
1128497101 15:68204952-68204974 TGTTGGCGGGGTGGGGGTTGGGG - Intronic
1129851763 15:78797658-78797680 TGTTGGCGGGGAGGGAGCAGAGG + Intronic
1131078326 15:89513231-89513253 TGTAGGGGGTGAGGGAGTTGGGG + Intergenic
1131982658 15:98010442-98010464 TCTGGTTGGTGTGGGAGTAGGGG + Intergenic
1132338823 15:101065441-101065463 TGTTGGCTGTGTGTGAGCACAGG - Exonic
1135332782 16:21574615-21574637 TGTTGGTGGGGTGGGGGAAGGGG - Intergenic
1138478016 16:57283618-57283640 TGTGGCTGGTGTGGGAGTGGAGG + Intronic
1138542197 16:57695227-57695249 TGGTGGGGGTGGGGGAGTGGTGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1140824002 16:78689157-78689179 TGTTGGTGGGGTGGAAGTAGAGG - Intronic
1141284232 16:82656176-82656198 AGCTGGCAGTGTGGGAGTGGGGG + Intronic
1141546038 16:84769838-84769860 GGGTGGCGGTGTGGGGGCAGGGG + Intronic
1142050661 16:87956012-87956034 TGAGGGAGGTGAGGGAGTAGGGG + Intronic
1143735033 17:8905625-8905647 TGCTGGAGGTGAGGGAGGAGGGG - Intronic
1143921550 17:10334209-10334231 AGTTGCCGGGGTGGGAGTGGTGG + Intronic
1144287461 17:13791770-13791792 TGTTGGCTGGGTGGGGGCAGAGG + Intergenic
1145037731 17:19552992-19553014 AGTTTGCGTTGTGGGAGCAGTGG + Intronic
1145265083 17:21376220-21376242 GGCTGGCGGTGTGTGTGTAGGGG + Exonic
1145814322 17:27784509-27784531 TGTTGGTGGTGTGGGTGTTATGG - Intronic
1146214184 17:30965683-30965705 GGTTGGCCATGTGGGAGAAGTGG + Intergenic
1146401316 17:32502096-32502118 TGGTGGTGGTGTGAGAGCAGAGG + Intronic
1146475974 17:33163076-33163098 TTCTGGTGGGGTGGGAGTAGGGG + Intronic
1146794652 17:35772785-35772807 AGTTGGGGGTGGGGGAGCAGTGG + Intronic
1147890147 17:43711321-43711343 GGTTGGCGGTTTGGGTGGAGAGG + Intergenic
1148494830 17:48047619-48047641 CGTTGGCGGTGTGAGAGGTGTGG - Intergenic
1149290388 17:55212900-55212922 TGTTGGTGGGGTGGTGGTAGAGG - Intergenic
1150473438 17:65456844-65456866 TGTGGGCTGGGTGGGGGTAGTGG - Intergenic
1151050537 17:70973550-70973572 AGGTGGTGGTGTGGGAGTCGGGG + Intergenic
1151199061 17:72454399-72454421 GGTTGGGGGTGAGGGAGTGGGGG - Intergenic
1151314061 17:73311230-73311252 GGTTCGCGGGGCGGGAGTAGGGG + Intronic
1151517633 17:74606564-74606586 TGTTGATGGTGTGGGAGCTGCGG - Intergenic
1152195543 17:78916191-78916213 TTTTGGAGGTGTGGAAGTGGGGG + Intronic
1152337872 17:79708256-79708278 TGATGGGGGTGGGGGAGGAGGGG - Intergenic
1153464952 18:5378849-5378871 TTTTGGCGGTGGGGGGGTGGGGG - Intergenic
1155595315 18:27479305-27479327 TGTTGGTGGTGTGAGTTTAGAGG - Intergenic
1155911279 18:31507072-31507094 TGTTGAGGCTGTGGGGGTAGGGG - Intronic
1156991501 18:43414150-43414172 TGTTGGGGCTGTGGGTGTCGAGG + Intergenic
1158057268 18:53296543-53296565 TGTGAGCAGTGTGAGAGTAGAGG + Intronic
1159759707 18:72409077-72409099 TGTGTGGGGGGTGGGAGTAGGGG - Intergenic
1160326788 18:77957538-77957560 TGGTGGTGGTGTTGGAGTTGGGG - Intergenic
1160394913 18:78564058-78564080 TGTGGGGGGTGTGGGAGGTGAGG - Intergenic
1161712227 19:5855325-5855347 GGTTGCCGGGGAGGGAGTAGGGG - Intergenic
1162782036 19:13011517-13011539 TTTTGGAGGGGTGGGAGCAGAGG + Intronic
1163817781 19:19477488-19477510 TGCAGGCGGTGTGGGAAGAGTGG + Intronic
1164219298 19:23178994-23179016 TGTTGCCAGAGAGGGAGTAGAGG - Intergenic
1165160139 19:33811201-33811223 TGATGTGGGTGTCGGAGTAGGGG - Intronic
1165487682 19:36105268-36105290 TGTGGGCAGTGTGGGAGGACTGG - Intergenic
1166026815 19:40094568-40094590 TGTCGGGGGTGGGGGACTAGAGG - Intergenic
1166093600 19:40525968-40525990 TGTGGGAGGAGTGGGAGGAGTGG + Intronic
1166302292 19:41918109-41918131 TGTGGGCAGTGTGGGAATGGGGG - Intronic
1166324634 19:42041769-42041791 TGAAGGGGGTGTGGGAGAAGGGG - Intronic
1167811682 19:51838285-51838307 TTTTAGCGGGGTGGGAGTATTGG + Intergenic
1167819231 19:51910750-51910772 TGTCGGGGGTGGGGGACTAGGGG + Intronic
925175267 2:1778953-1778975 TGTTGGTGGGGTGGGGGGAGTGG + Intergenic
926312030 2:11681960-11681982 GGTTCGCGGTATGGGAGAAGTGG - Intronic
926693898 2:15757180-15757202 TGGTGGAGGTGTGGGAGAATGGG + Intergenic
927116991 2:19914932-19914954 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
927216674 2:20671347-20671369 TGTTGGCGGCGTCGATGTAGAGG - Exonic
927216917 2:20672586-20672608 TGTTGGCAGTGTGATAGTAACGG + Exonic
927578483 2:24220203-24220225 TGTTGGGTGTGTGGGGGTAGGGG + Intronic
927752790 2:25684956-25684978 TTTTGGCGGGGTGGGGGTGGGGG - Intergenic
928566114 2:32551711-32551733 TTTTGGCAATGTGGGAGTTGAGG + Intronic
929385059 2:41396393-41396415 TGTTGGAGGTGGGGGTCTAGTGG - Intergenic
929558118 2:42938042-42938064 TGTTGGTGGCGTGGGAGTGGGGG - Intergenic
929584650 2:43106081-43106103 TGGTGGGGGTGTGGGAGTGAGGG - Intergenic
929613113 2:43286451-43286473 TGTTGGTGGTCTGGGAGTGGTGG + Intronic
932287144 2:70544878-70544900 AGTGGGTGGTGTGGGAGTGGAGG + Intronic
932513785 2:72323830-72323852 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
932617900 2:73247265-73247287 TGTTGGGGGTGTGGGGGTGGAGG + Intronic
932907543 2:75769794-75769816 TCTAGGCTGTGTGGGGGTAGAGG - Intergenic
933269897 2:80222023-80222045 TGTTGGCTGTTTGGCAGTGGTGG - Intronic
933425304 2:82103766-82103788 TGTTGGTGGTGTGGTTGTATTGG - Intergenic
935149623 2:100422161-100422183 AGTGGGTGGGGTGGGAGTAGCGG - Intergenic
938192571 2:129297025-129297047 GGTTGGAGGCGTGGGAGGAGAGG + Intergenic
938301355 2:130216096-130216118 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
938462808 2:131509038-131509060 TGGAGGAGGTGGGGGAGTAGGGG - Intergenic
938778092 2:134559697-134559719 TATTGTGGGTGTGGGATTAGGGG - Intronic
940178047 2:150901000-150901022 TGTTGAGGGTGTGGGAGTTTGGG - Intergenic
940343296 2:152603229-152603251 TGGTGGAGCTGTGGTAGTAGGGG + Intronic
940417544 2:153440096-153440118 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
940786631 2:157988612-157988634 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
943009908 2:182434622-182434644 TGATTTCGGTGTGGTAGTAGAGG - Intronic
944482193 2:200169149-200169171 TTTTTGCGGGGTGGGAGGAGAGG + Intergenic
946029588 2:216693874-216693896 TGTTTGTGGTGTGTGTGTAGGGG + Intronic
947543684 2:230995756-230995778 TTTTTGAGGTGTAGGAGTAGGGG + Intergenic
949050895 2:241896710-241896732 TGTTGGGGGTGTGTGTGTTGGGG + Intronic
1169552301 20:6713612-6713634 TGTTGCAGGTGTGGGAAAAGGGG + Intergenic
1170318487 20:15068466-15068488 TGTTGGAGGTGGGGGTCTAGTGG + Intronic
1170580329 20:17694351-17694373 TGTTGAAGATGTGGGAGCAGAGG + Intronic
1171502067 20:25601434-25601456 TGTTAGGGGTGTGTGTGTAGTGG - Intergenic
1171524531 20:25798710-25798732 TTGTGGCGGCGTGGGAGAAGGGG + Intronic
1171552296 20:26057173-26057195 TTGTGGCGGCGTGGGAGAAGGGG - Intergenic
1171841059 20:30212214-30212236 TCTTTGTGGTGTGAGAGTAGAGG - Intergenic
1172028907 20:31968154-31968176 TGTTGGCGGAGAGGGAGGCGGGG - Exonic
1173602616 20:44306849-44306871 TGATGGCGGTGTGGAGGCAGTGG + Exonic
1173801837 20:45898953-45898975 TGTGGACGGTGTGGGGGCAGTGG + Exonic
1176082499 20:63281075-63281097 AGTTGGCGAGGTGGGGGTAGAGG + Intronic
1176103731 20:63376051-63376073 TGGTGGGGGTGTGGGGGTGGTGG - Intronic
1176169470 20:63690461-63690483 GGTGGGCGGTGTGGGGGTGGCGG + Intronic
1176857394 21:13983987-13984009 TGGTGGCGTTGGGGGAGTGGAGG + Intergenic
1177186332 21:17801690-17801712 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
1177782909 21:25639569-25639591 TTTTGGGGGTGTGGGGGTAGGGG - Exonic
1178258145 21:31074207-31074229 TGTTTGTGGTGGGGGAGTGGTGG - Intergenic
1179521884 21:41951080-41951102 TGATGGCGGTGTGGGAGAGCAGG - Intronic
1179817656 21:43917916-43917938 TGTAGGGGGTGTGGGTGTTGTGG + Intronic
1179817670 21:43917952-43917974 TGTAGGGGGTGTGGGTGTTGGGG + Intronic
1179817690 21:43918035-43918057 TGTTGGTGTTGTGGGGGTTGTGG + Intronic
1179817697 21:43918059-43918081 TGTTGGGGTTGTGGGTGTTGTGG + Intronic
1179817714 21:43918138-43918160 TGTTGGAGTTGTGGGTGTTGTGG + Intronic
1179817716 21:43918147-43918169 TGTGGGTGTTGTGGGAGTTGTGG + Intronic
1179817720 21:43918165-43918187 TGTGGGTGTTGTGGGAGTTGTGG + Intronic
1183472942 22:38019207-38019229 TGTGGGCGGGGTCAGAGTAGGGG + Intronic
1183748018 22:39703595-39703617 TGTGGGGGGTGTGGGTGTGGGGG - Intergenic
1183773053 22:39943540-39943562 GGTTGGCGGGGTGGGGGTTGGGG + Intronic
1183952448 22:41359119-41359141 TGCTGGTGGTGTGGCTGTAGGGG + Exonic
1185294046 22:50044676-50044698 TGTTGGCGGTGCAGGAGGCGCGG + Intronic
1185369344 22:50453808-50453830 TGTTGGCTGTGTGGCCTTAGAGG - Intronic
949203602 3:1411138-1411160 TGTTGGGGGTGGGGGACAAGGGG - Intergenic
949876572 3:8629768-8629790 TGTTATGGGTGTGGGAGAAGTGG - Intronic
950309983 3:11948749-11948771 TGATGGCGGGGTGGGGGTGGGGG + Intergenic
950641796 3:14353362-14353384 TTCTGGGGGTGTGGGAGCAGTGG - Intergenic
951977299 3:28526951-28526973 TGTTGGGGGTGGGGGGCTAGGGG - Intronic
952155819 3:30642297-30642319 TGGTGGTGGGGTGGGAGTGGGGG + Intronic
953507057 3:43496617-43496639 TTTTGGGGGTGGGGGAGCAGGGG + Intronic
954337672 3:49929329-49929351 TGTTGGCGGGGCGGGGGTGGGGG + Intronic
955213374 3:56962631-56962653 TGTTGGAGGGGTTGGAGTTGGGG + Intronic
955958660 3:64316724-64316746 TGGTGGTGGTATGAGAGTAGAGG + Intronic
957343017 3:78925792-78925814 TGTGGTGGGTGTGGGAGGAGTGG + Intronic
957530246 3:81431522-81431544 TGTTGGGGGTGGGGGGGTAGGGG + Intergenic
958510232 3:95038025-95038047 TGTTGTTGGTGGGGGACTAGGGG - Intergenic
959743345 3:109747286-109747308 TTCTGTGGGTGTGGGAGTAGTGG + Intergenic
960929069 3:122825856-122825878 TATTGGGGGTGAGGGAGTAATGG + Intronic
960941297 3:122936776-122936798 TGTTGGAGGTGGAGGAGTGGGGG - Intronic
961038271 3:123658717-123658739 TGCTGGAGGTGGGAGAGTAGCGG - Intronic
963312162 3:143721182-143721204 TTTTGGGGGTGTGGGGGAAGTGG - Intronic
964391976 3:156207203-156207225 AGGTGGCAGGGTGGGAGTAGTGG + Intronic
965966693 3:174500426-174500448 TGTTTGGGGAGTGGGAGGAGGGG - Intronic
967497268 3:190155762-190155784 TCTAGGGGCTGTGGGAGTAGCGG + Intergenic
967550982 3:190795966-190795988 TGTTGGAGATGAGGGAGGAGTGG - Intergenic
967849092 3:194069184-194069206 TGAAGGCGGTTTGGGAGTGGAGG - Intergenic
968523622 4:1045667-1045689 TGATGGGGGTGTGGGTGGAGGGG + Intergenic
969047277 4:4345627-4345649 TGTTGGGGGTGGGGGTTTAGGGG - Intergenic
969324386 4:6432466-6432488 TGTTGAAGGTGCTGGAGTAGAGG - Intronic
970233970 4:13940001-13940023 TGGTGGTGGTGTGAGAGCAGAGG - Intergenic
972213124 4:36862410-36862432 TGGTGGCTGAGTGGGAGAAGGGG + Intergenic
972931924 4:44082596-44082618 TTTGGGGGGTGTGGGGGTAGGGG + Intergenic
973247238 4:48022462-48022484 TGTAGGGGGTGTGGGAGCAGAGG - Intronic
973744089 4:53946402-53946424 TGGTGGTGGTGTGAGAGCAGAGG + Intronic
973854382 4:54996154-54996176 TGTTGGAGCTGAGGGAGTAGGGG - Intergenic
974145995 4:57948083-57948105 TTTTGGGGGTGAGGGTGTAGGGG + Intergenic
974299367 4:60043047-60043069 TGTTGGGGGTGGAGGAGGAGTGG + Intergenic
974597350 4:64030922-64030944 TGTTGGGGATGGGGGAGCAGTGG + Intergenic
974763116 4:66305083-66305105 TGTGGGTGCTGTGGGGGTAGGGG + Intergenic
976549135 4:86374252-86374274 TGTTGGGGGTGGGGGACTAGGGG + Intronic
977113246 4:92987436-92987458 TGTTGTGGGGGTGGGAGGAGGGG + Intronic
977650829 4:99467275-99467297 TCTTGGAGGTGTGGTAGTGGAGG + Intergenic
978025020 4:103862771-103862793 TGTTGGAGGTGGGGGCCTAGTGG - Intergenic
978150545 4:105428665-105428687 TGTTGGGGGTGGGGGGCTAGGGG + Intronic
978700955 4:111645628-111645650 TTTGGGCAGTATGGGAGTAGAGG + Intergenic
979267532 4:118720719-118720741 TGTTGGGGGTGGGGGAATTGGGG - Intergenic
980121707 4:128734706-128734728 TGGTGGTGGTATGAGAGTAGAGG - Intergenic
980539629 4:134177097-134177119 TGGTGGGGGTGTGGCAGGAGTGG - Intergenic
985430164 4:189871544-189871566 TTTTTGTGGTGTGAGAGTAGAGG - Intergenic
986117245 5:4788082-4788104 AGTTGGCAGTGGGGGAGGAGAGG + Intergenic
986799032 5:11240787-11240809 TGTTGGGTGTGTGGGGGTTGGGG - Intronic
988696368 5:33626326-33626348 TGGTGGTGATGTGGTAGTAGTGG + Intronic
990775378 5:59300614-59300636 TTTTTGTGGTGTGAGAGTAGAGG - Intronic
991026113 5:62031820-62031842 TGTCGGGGGTGGGGGACTAGGGG - Intergenic
991945524 5:71895139-71895161 TGGTGGCAGGGTGGGGGTAGAGG - Intergenic
992307483 5:75457746-75457768 TCTTGGGTGTGTGGGTGTAGGGG + Intronic
992614119 5:78533452-78533474 TGTTCACGCTGTGAGAGTAGGGG + Intronic
993640990 5:90405260-90405282 TGTTGGCTAAGTGGGAGAAGAGG - Intronic
993810484 5:92470316-92470338 TGGTGGTGGTATGAGAGTAGAGG - Intergenic
994121334 5:96116982-96117004 GCTTGGCGGGGTGGCAGTAGTGG + Intergenic
994161487 5:96561558-96561580 TGTTGGGGGTGGGGAGGTAGGGG + Intronic
994965893 5:106670281-106670303 TGGTGGAGGTGTGGCAGGAGTGG - Intergenic
994978119 5:106837858-106837880 TGTTGGGGGTGGGGGACTAGGGG - Intergenic
995015190 5:107301965-107301987 TCTGGGCAGTGTGGGAGGAGAGG + Intergenic
995309107 5:110690969-110690991 TGTTGGGGGTGTGGGGGTAGGGG + Intronic
995835977 5:116399907-116399929 TTTTGGGGGTGGGGGAGCAGGGG - Intronic
996323534 5:122246962-122246984 TGTTGGCGGTTGGGGGCTAGGGG - Intergenic
997670985 5:135671852-135671874 GGGTGGGGGTGGGGGAGTAGAGG - Intergenic
998807513 5:145933377-145933399 TGTTGGTGGGGTGGGAACAGCGG + Intergenic
999722999 5:154412622-154412644 GGTTGGTGGTGGGGGAGTGGAGG - Intronic
1000155933 5:158551889-158551911 TTTTGGCTGTGTGGGATTGGTGG - Intergenic
1001436134 5:171701025-171701047 TGTTGGGGGGGTGGGGGTAGAGG - Intergenic
1004057477 6:12154635-12154657 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1005161598 6:22870690-22870712 TGTTGGGGGTGGGAGACTAGGGG + Intergenic
1005806792 6:29480997-29481019 TGTTGGGGGTGGGGGTCTAGGGG - Intergenic
1006002428 6:30975886-30975908 TGGTGGTGGTGTGAGAGCAGAGG - Intergenic
1006206920 6:32354093-32354115 TGTTGGGGGAGAGTGAGTAGAGG + Intronic
1006333928 6:33410880-33410902 TGTTGGAGGTGAGGGAGGTGGGG + Intronic
1006575771 6:35044451-35044473 TGTCTGAGGTGAGGGAGTAGAGG + Intronic
1007238793 6:40410365-40410387 TATTGGGGTTGTGGAAGTAGGGG + Intronic
1009380880 6:63028136-63028158 TGTTGGTGGTGGGGGAGAATAGG - Intergenic
1009995137 6:70888597-70888619 TGTTGGCAGTGTGGGATGAATGG - Intronic
1012268887 6:97183158-97183180 TGTTGGAGTTGGGGGAGAAGAGG - Intronic
1012381049 6:98619872-98619894 TGTGGTAGGTGTGGGGGTAGAGG - Intergenic
1012384511 6:98663551-98663573 TGTTGGAGGGGTGGGAGGAAAGG - Intergenic
1012391910 6:98751219-98751241 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1012644103 6:101658200-101658222 TGTTGGGGGTGAGGGACTAGGGG - Intronic
1013020119 6:106206251-106206273 TGTTGGGGGGGTGGGGGTGGGGG + Intronic
1013664313 6:112331038-112331060 TGGTGGTGGTGTGGGGGGAGGGG + Intergenic
1014748077 6:125223276-125223298 TGTTGGCTGTGTGAGAGAATGGG - Intronic
1015162618 6:130170193-130170215 TGTTGGCGGTGGGGGACAAGGGG - Intronic
1015214091 6:130730042-130730064 TGTCGGGGGTGAGGGACTAGGGG + Intergenic
1016412337 6:143796556-143796578 TGTAGGGGGTGGGGGACTAGGGG - Intronic
1017087779 6:150730330-150730352 TGGTGGGGGTGTGGGGGTGGGGG + Intronic
1017264195 6:152423432-152423454 TGTTGGTGGGGAGGGAGGAGTGG - Intronic
1018199005 6:161378366-161378388 TGTTGGCGGTGTGGCAGATGGGG - Intronic
1019484051 7:1280267-1280289 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1020568298 7:9824696-9824718 TGTTGGGGGTGAGGGATGAGGGG - Intergenic
1020759879 7:12255126-12255148 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1021897500 7:25250813-25250835 TGGTGGCTGTGTGAGAGAAGTGG - Intergenic
1022688846 7:32625087-32625109 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1022772225 7:33486031-33486053 TGTTGGCGGTGTGGGAGTAGGGG + Intronic
1024103968 7:46062357-46062379 TGTTGGCTGGGTGGGAGGGGAGG + Intergenic
1025581305 7:62721829-62721851 TGTTGGGGGGGTGGGGGGAGGGG + Intergenic
1025581773 7:62728742-62728764 TGTTGGGGGGGTGGGGGGAGGGG - Intergenic
1026081635 7:67226838-67226860 TGTTAACTGTGTGGGAGTAGAGG - Intronic
1026173175 7:67972467-67972489 TGTTGGGGTTGTGGGGGTTGGGG + Intergenic
1026695437 7:72587159-72587181 TGTTAACTGCGTGGGAGTAGAGG + Intronic
1026854472 7:73743848-73743870 TGTTGGAGGTTAGGGAGCAGAGG - Intergenic
1027777613 7:82486186-82486208 TGTTGGAGGTGGGGGGCTAGGGG - Intergenic
1029260148 7:99296628-99296650 TGGTGGGGGGGTGGGAGTAGGGG + Intergenic
1029869678 7:103677257-103677279 TGTGGGGGGTGGGGGACTAGGGG + Intronic
1031249283 7:119358626-119358648 TTGTGGAGGTGTGGGAATAGTGG + Intergenic
1031796998 7:126187149-126187171 TGTGGGTGGTGTGGGGGTTGAGG + Intergenic
1033229288 7:139583988-139584010 TGCTGGAGGAGTCGGAGTAGGGG + Exonic
1033747440 7:144332252-144332274 TGTTGGCGGGGGGGGTGTGGTGG + Intergenic
1034499024 7:151438336-151438358 TTTTGGGGGCCTGGGAGTAGGGG - Intronic
1035782812 8:2242271-2242293 TGTTGGAGGTGGGGGACAAGGGG + Intergenic
1035809318 8:2477314-2477336 TGTTGGAGGTGGGGGACAAGGGG - Intergenic
1035827810 8:2663305-2663327 TGTTGGCGGTGGGGGACAAGGGG - Intergenic
1036195901 8:6714616-6714638 TGTACGCAGTGTAGGAGTAGGGG - Intronic
1037481989 8:19313860-19313882 TGTGCGTGGGGTGGGAGTAGGGG + Intronic
1039803932 8:40982894-40982916 TGTTGTTGGTGTGAAAGTAGAGG + Intergenic
1040770529 8:50970034-50970056 TGTGGTGGGTGTGGGAGTGGTGG - Intergenic
1040886242 8:52266857-52266879 TGTTGGTGGCTTGGGATTAGAGG + Intronic
1041101304 8:54398828-54398850 TTTTGGCGGCGGGGGAGTGGGGG - Intergenic
1041220810 8:55649042-55649064 TGGTGGGAGTATGGGAGTAGGGG + Intergenic
1042714326 8:71755951-71755973 TGTTGGAGGAGTGGGGGTGGGGG + Intergenic
1043161505 8:76853040-76853062 TGGTGGTGGTGGGGGAGGAGTGG - Exonic
1043874276 8:85466339-85466361 TGGTGGTGGTGTGGGAGTGAGGG + Intronic
1044100202 8:88126067-88126089 TGTTGCTGGTCTGGAAGTAGTGG - Intronic
1045075024 8:98555882-98555904 TGATGGGGGTGGGGGATTAGTGG + Intronic
1045368364 8:101496569-101496591 TGTTGGGGGTGGGGGAAAAGGGG + Intronic
1045991611 8:108314919-108314941 TGTGGCTGGTGTGAGAGTAGAGG + Intronic
1046003292 8:108447205-108447227 TGTTGGGGGTGGGGGGGCAGTGG - Intronic
1047255411 8:123210007-123210029 GGTTGGTGGGGTGGGAGTGGGGG - Intronic
1047345427 8:124023429-124023451 TGCTGGGGCTGTGGGAATAGAGG - Exonic
1047852101 8:128868240-128868262 TGTTGGGGGTGAGGGGTTAGGGG - Intergenic
1049423360 8:142526504-142526526 TGGTGGGGGTGTGGGGGTGGGGG - Intronic
1049463940 8:142742594-142742616 TGTTGGAGGTGTGCAAGCAGAGG - Intergenic
1050265470 9:3884943-3884965 TGTTTGTGGTGGGGGATTAGTGG - Intronic
1052125588 9:24770661-24770683 TGTTGGCTGGTTGGGAGTTGGGG + Intergenic
1052949066 9:34193367-34193389 TTGTGGTGGTGTGAGAGTAGAGG - Intronic
1053016093 9:34663150-34663172 TGTGGGTGGGGTGGGAGCAGAGG + Intronic
1053316822 9:37059154-37059176 TGTTGGGGGTGGGGGAGGAGGGG - Intergenic
1053329632 9:37191487-37191509 TTTTAGTGGGGTGGGAGTAGGGG - Intronic
1056979091 9:91291305-91291327 TGTTGGGGGGGTGGGGGTGGAGG + Intronic
1058929255 9:109702587-109702609 TGTTGTGGGGGTGGGGGTAGGGG + Intronic
1058934939 9:109761520-109761542 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1058942489 9:109826209-109826231 TGTTGTGGGGGTGGGGGTAGGGG + Intronic
1059713634 9:116893009-116893031 TGTTGGGAGTTTGGGAGTACCGG - Intronic
1060198163 9:121636459-121636481 TGGTGGCTGGGTGGGAGGAGAGG + Intronic
1060900547 9:127253701-127253723 GGTTGGGGGTGTGGGAGTGATGG + Intronic
1061448523 9:130655968-130655990 TGTTGACGGTTTGGGAGCTGGGG + Intergenic
1061653661 9:132070785-132070807 GGTGGGGGGTGTGGGAGTCGAGG - Intronic
1061677438 9:132226307-132226329 TGACGGGGGTGTGGGAGTTGGGG + Intronic
1061937818 9:133867922-133867944 TGTAGGCGGTGTGGGAGGAGTGG - Intronic
1062021438 9:134321220-134321242 TGCTGGCAGTGTGGGGGTGGAGG + Intronic
1062451387 9:136617172-136617194 TGATGGGGGTGTGGGATTGGGGG + Intergenic
1062542693 9:137048583-137048605 TGTGGGAGGGGTGGGAGTACGGG + Exonic
1062564357 9:137157339-137157361 TGCTGGGGGTGTGGGGGGAGAGG - Intronic
1186631707 X:11356258-11356280 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1186712202 X:12210714-12210736 TGTTGTCGGTGGGGGAGGCGGGG - Intronic
1186819945 X:13277411-13277433 CCTTGGTGGTGTGGGAGTGGGGG + Intergenic
1187128954 X:16482223-16482245 GGTTGGGGGTGTGGGGGGAGGGG + Intergenic
1188968121 X:36580027-36580049 GGTTGGCAGAGTGGGAGTTGGGG - Intergenic
1189946083 X:46180310-46180332 TGTGGCTGCTGTGGGAGTAGGGG + Intergenic
1190157098 X:48003427-48003449 AGTTGGGGGCGTGGGAGGAGGGG - Intronic
1192540339 X:71964209-71964231 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1192971857 X:76239902-76239924 TGTCGGGGGTGTGGGACAAGTGG + Intergenic
1193076360 X:77360001-77360023 TGGTGGCGGAGTGGGGGTGGAGG + Intergenic
1193160706 X:78226048-78226070 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1193201582 X:78697683-78697705 TGTTGGAGGTGGGGGGCTAGGGG + Intergenic
1193419372 X:81265355-81265377 TGTGGCGGGTGTGGGACTAGGGG - Intronic
1193438517 X:81510104-81510126 TATTGGGGGTGGGGGACTAGGGG + Intergenic
1193552952 X:82921573-82921595 TGTTGGGGGTGTGGGGCAAGGGG - Intergenic
1193568883 X:83116893-83116915 TGTTGGGGGTGGGGGGCTAGGGG - Intergenic
1195075843 X:101326515-101326537 TGTTGGTGGGGTGGGGGTGGGGG + Intergenic
1196007645 X:110852912-110852934 TGTAGGAGGTGGGGGAGCAGGGG - Intergenic
1196159569 X:112467807-112467829 TGTGGGGGGTGGGGGACTAGGGG + Intergenic
1196536377 X:116850311-116850333 TGTTGGGGGTGGGGGTGTTGGGG - Intergenic
1196810489 X:119625260-119625282 TGTTGGGGGTGCGGGATTGGGGG + Intronic
1197682448 X:129400966-129400988 TATTGGGGGTGGGGGACTAGAGG - Intergenic
1199080070 X:143567175-143567197 TGTTGGGGGTGGGGGTGTGGAGG + Intergenic
1199546648 X:149013470-149013492 TGTTGGAGGGGTGGAAGAAGGGG - Intergenic
1199964438 X:152807783-152807805 AGAAGGCAGTGTGGGAGTAGGGG + Intergenic
1200712446 Y:6499718-6499740 TGTTGGGGGTAGGGGACTAGTGG - Intergenic
1201021469 Y:9662239-9662261 TGTTGGGGGTGGGGGGCTAGTGG + Intergenic
1201073699 Y:10171276-10171298 TGTAAGCCGTGTGGGAGCAGGGG + Intergenic
1201939209 Y:19440905-19440927 TGTTGGGGGTGGGGGGCTAGGGG + Intergenic
1202036417 Y:20641392-20641414 TGTTGGCGGGGTGGTGGGAGGGG - Intergenic