ID: 1022772609

View in Genome Browser
Species Human (GRCh38)
Location 7:33490653-33490675
Sequence AGTACAAATTGAGCACCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022772609_1022772611 21 Left 1022772609 7:33490653-33490675 CCAGTGGGTGCTCAATTTGTACT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1022772611 7:33490697-33490719 ATATATTTTATTTTTTCTCAGGG 0: 1
1: 1
2: 17
3: 233
4: 2233
1022772609_1022772610 20 Left 1022772609 7:33490653-33490675 CCAGTGGGTGCTCAATTTGTACT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1022772610 7:33490696-33490718 CATATATTTTATTTTTTCTCAGG 0: 1
1: 0
2: 15
3: 164
4: 1550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022772609 Original CRISPR AGTACAAATTGAGCACCCAC TGG (reversed) Intronic
900163258 1:1234565-1234587 AGAACAAACTGTGCACACACGGG - Exonic
901734538 1:11304164-11304186 AGCCCAAATTGGCCACCCACGGG - Intergenic
904907619 1:33909885-33909907 AGCACAAAATGAGCACCAATAGG - Intronic
906516055 1:46439489-46439511 AGTCCAACTTCAGAACCCACAGG - Intergenic
907461724 1:54609257-54609279 GGTAGAAACTGAGCACCCAGGGG - Exonic
912950871 1:114119304-114119326 AGTATAAATTGAGTACCTACTGG + Intronic
913350268 1:117850657-117850679 AGTAGATATTAAGCACCCATTGG + Intergenic
913404921 1:118479526-118479548 AGTCCAAATTGTTGACCCACAGG + Intergenic
914696385 1:150084956-150084978 GGTATAACTAGAGCACCCACAGG - Intronic
1067842605 10:49693384-49693406 AGTACAAATTGAACACCTTCTGG - Intronic
1069314981 10:67087111-67087133 AGTACCAATTTAGCAGGCACTGG + Intronic
1079883044 11:25950616-25950638 ACTAAATATTGAGCACCCACAGG + Intergenic
1081339377 11:41908010-41908032 AGCACAAATAGAGGACCTACAGG - Intergenic
1083699439 11:64465844-64465866 AGGAGAAATTGAACAGCCACAGG - Intergenic
1086482276 11:87255010-87255032 ACTACAAATTGAGGAGCCAAAGG + Intronic
1087460712 11:98442923-98442945 AGTACACATTCAGCAGCCATTGG + Intergenic
1088129236 11:106467014-106467036 AATACAAATTAAGCACCAGCTGG - Intergenic
1088649577 11:111945740-111945762 AGTACACATAGAACAACCACAGG + Intronic
1091087894 11:132741001-132741023 AGTTCAAATCCAGCATCCACTGG + Intronic
1091825723 12:3511259-3511281 AGCACGAATTCAGCACCCATGGG - Intronic
1093119913 12:15256776-15256798 AACACATATTGAACACCCACAGG + Intronic
1093905178 12:24682495-24682517 AGTACAGAATTATCACCCACTGG - Intergenic
1096514326 12:52147870-52147892 TGTCCAAACTGTGCACCCACTGG + Intergenic
1098610724 12:72453880-72453902 AGGAAAACTTGTGCACCCACAGG - Intronic
1098929752 12:76397447-76397469 AGTACAAATTGAATCCCCAAGGG + Intronic
1099668161 12:85657800-85657822 AGTACCAATTGATTACCAACTGG + Intergenic
1105553131 13:21417332-21417354 AGTACTTCTTGACCACCCACCGG - Intronic
1107085754 13:36426454-36426476 ACTAAAAATTGAGCTACCACAGG + Intergenic
1109799621 13:67359116-67359138 AGTACTTATTGAACACCCATTGG + Intergenic
1111465423 13:88602360-88602382 AGGACAAAGTGAGCACATACAGG - Intergenic
1112125650 13:96464681-96464703 AGTAGAATTTGATCACCTACTGG + Intronic
1114937579 14:27561917-27561939 AGAACACATGGAGCACCCATTGG - Intergenic
1120260212 14:82174954-82174976 AGTACATATGGAGCAGCCACTGG + Intergenic
1120474322 14:84968492-84968514 AGTAGTTATTTAGCACCCACAGG + Intergenic
1124558538 15:30749362-30749384 GGCAAAGATTGAGCACCCACTGG + Intronic
1124672711 15:31656268-31656290 GGCAAAGATTGAGCACCCACTGG - Intronic
1125668020 15:41447772-41447794 ATGAGAAAATGAGCACCCACCGG - Intronic
1127499341 15:59542056-59542078 AGCACAAATAGATCACACACAGG + Intergenic
1128737194 15:70059910-70059932 TGGACACATTGAGCACCCAAAGG - Intronic
1129781225 15:78272774-78272796 AGTACTAATTGAGAAACCAAAGG - Intronic
1134775689 16:16851377-16851399 AGCAAAAATTGATCACTCACTGG - Intergenic
1134912650 16:18041891-18041913 AGTAAAAATTGAGCTTCCCCTGG - Intergenic
1135757218 16:25108132-25108154 AGTAGAACTCAAGCACCCACTGG + Intergenic
1139147003 16:64337438-64337460 AGTAAAAATTGAGCATAAACAGG + Intergenic
1147377193 17:40029553-40029575 TGTACAAATGAAGCTCCCACGGG + Intronic
1151091569 17:71445813-71445835 AGTAGAAATGGAGGACACACGGG + Intergenic
1155393833 18:25365712-25365734 ATTACAAATTGAGTTCCCATAGG + Intergenic
1155423287 18:25679152-25679174 AATACAAACATAGCACCCACAGG + Intergenic
1159594051 18:70365619-70365641 AGTACACATTTAGCATCCACTGG - Intergenic
1168675894 19:58277906-58277928 ATCACAAAGTGAACACCCACAGG + Intronic
1168715598 19:58525324-58525346 AGTACTAAATGAGTACACACAGG + Intronic
929992761 2:46803556-46803578 AGCGCACATTGAGCACCTACTGG - Intergenic
932387955 2:71355449-71355471 ATTTCAAAATGAGCATCCACGGG + Intronic
933520168 2:83361755-83361777 AATCAAAATTGAGCACCCAAAGG + Intergenic
933700107 2:85248944-85248966 AGTATTTATGGAGCACCCACAGG - Intronic
934501605 2:94864256-94864278 AATACAAATAGAACACCAACAGG - Intergenic
936228606 2:110680149-110680171 AGTTCAACATGAGCAGCCACCGG - Intergenic
937494602 2:122404300-122404322 AGTAGAAATTTAACACCCAAAGG - Intergenic
940357381 2:152758927-152758949 AAAACAAATTGAGGACACACAGG - Intronic
940777813 2:157902964-157902986 AGTAGAAATTCAGTATCCACTGG + Intronic
941838771 2:170055692-170055714 ATTGTAAATTGAGCACCTACAGG + Intronic
944511633 2:200471584-200471606 AGAGCACATTGAGAACCCACAGG + Intronic
1168851867 20:982558-982580 AGTACTCACTGAGCACCTACTGG - Intronic
1169034615 20:2439354-2439376 AGTAGAAATTAAGCACACATTGG - Intergenic
1169045865 20:2534171-2534193 AGATAAAAATGAGCACCCACTGG - Intergenic
1174112405 20:48205615-48205637 TTTACACAGTGAGCACCCACTGG + Intergenic
1174168831 20:48603904-48603926 TTTACACAGTGAGCACCCACCGG - Intergenic
1175241535 20:57553177-57553199 AGTGGAAATTGAGCACCCTCAGG - Intergenic
1176889105 21:14292860-14292882 AGTACAAATTGAGCAGTAAATGG + Intergenic
1177043937 21:16146228-16146250 AGTACGACTTGAGCACCCCTTGG - Intergenic
1185323804 22:50215865-50215887 AGTAGGAACTGAGTACCCACCGG - Exonic
950959314 3:17088405-17088427 AGAATAAATTGAGAACCCAAGGG + Intronic
955443831 3:58985923-58985945 AGTACACATTGAACAGACACTGG + Intronic
962441666 3:135424769-135424791 AGTACACATGGAGCACCCATGGG + Intergenic
963604992 3:147406067-147406089 GGTACAAATGGGGCTCCCACTGG - Intronic
967449439 3:189606674-189606696 AGTACAAAATGAGTAGGCACAGG + Intergenic
973692903 4:53457267-53457289 AGTACAAGTGGAGTACACACAGG - Intronic
978688871 4:111483301-111483323 AGTACAATCTGAGCACCCCTTGG + Intergenic
985372341 4:189299346-189299368 AGTACAAACTGAGCCACCTCTGG - Intergenic
989745290 5:44821701-44821723 AGTACAGATTGGGTACCCACTGG - Intergenic
996028999 5:118684292-118684314 AGCACTTATTGAGCACCTACTGG + Intergenic
996802921 5:127423291-127423313 AGTACAAATTCTGTAACCACAGG + Intronic
998608587 5:143663134-143663156 AGCATGTATTGAGCACCCACTGG - Intergenic
1000576307 5:162979501-162979523 AGTAAAAATGGAGCTGCCACTGG + Intergenic
1003720423 6:8695561-8695583 TTTTTAAATTGAGCACCCACAGG + Intergenic
1007451930 6:41946782-41946804 AGTAAAAATTGAGCACTCTTCGG + Intronic
1008322003 6:50126087-50126109 AGGACAAATAAAGCACTCACAGG + Intergenic
1015596949 6:134875058-134875080 GGTACAGATGGAGCACCCAGGGG - Intergenic
1015816492 6:137216987-137217009 CGTGCAAATTGTGCACTCACAGG + Intronic
1019077171 6:169396965-169396987 AGTGCAAAATCAGCACTCACAGG + Intergenic
1019217632 6:170453906-170453928 TGTTCAAATTCAGCAGCCACAGG - Intergenic
1020777581 7:12473843-12473865 AGTTCAAACTGAGCCTCCACAGG - Intergenic
1021541813 7:21768000-21768022 AGTACACACTCAGCACCCAGGGG + Intronic
1022078308 7:26995103-26995125 AGTACAAATTTCCCACCAACTGG - Intronic
1022772609 7:33490653-33490675 AGTACAAATTGAGCACCCACTGG - Intronic
1030526932 7:110666114-110666136 AGGACACATAGAGCTCCCACTGG - Intronic
1032675337 7:134124974-134124996 AGTAAAAATTGAGCAACAAGAGG + Intergenic
1033236034 7:139638452-139638474 AATACTAACTGAGCACCCACTGG + Intronic
1035872171 8:3147609-3147631 AGTAAAATTTGAGCACCCTGGGG + Intronic
1039308589 8:36291637-36291659 AGTACACATAGAGCAGCAACTGG + Intergenic
1040457344 8:47611785-47611807 AGCAAAAATTAAGCAACCACAGG + Intronic
1051915386 9:22200835-22200857 AGTACAACCTGAGCACCCCTTGG - Intergenic
1051951999 9:22647257-22647279 AGTATAATATGAGAACCCACTGG - Intergenic
1052011101 9:23410314-23410336 AGTATAAAATAAGCACCCATGGG + Intergenic
1057360636 9:94370620-94370642 ATTACAAATTGACCACACAAGGG + Intergenic
1057662707 9:97017471-97017493 ATTACAAATTGACCACACAAGGG - Intergenic
1189128037 X:38468663-38468685 AGTACAAATTGGGCACCAGCTGG + Intronic
1189762110 X:44332464-44332486 GGTAGAATTTGAGCACCCAGGGG + Intronic
1193221892 X:78935534-78935556 AGTCCAACCTGAGCACCCATTGG - Intergenic
1194572403 X:95569130-95569152 ACTAAAAATAGAGCAACCACAGG + Intergenic
1196894645 X:120322807-120322829 AGTAAAAACTGACAACCCACAGG + Intergenic
1196898953 X:120364534-120364556 ACTACATTTTGAGCACCCAGAGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1202379786 Y:24266257-24266279 AATACATATTGAGCACCATCAGG + Intergenic
1202490996 Y:25403864-25403886 AATACATATTGAGCACCATCAGG - Intergenic