ID: 1022776402

View in Genome Browser
Species Human (GRCh38)
Location 7:33532025-33532047
Sequence TGGTATTCCCTGAGAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022776402_1022776404 5 Left 1022776402 7:33532025-33532047 CCAGTCACTCTCAGGGAATACCA 0: 1
1: 0
2: 2
3: 13
4: 119
Right 1022776404 7:33532053-33532075 GCAAACAGCACCCACGTCACAGG 0: 1
1: 1
2: 0
3: 17
4: 122
1022776402_1022776405 6 Left 1022776402 7:33532025-33532047 CCAGTCACTCTCAGGGAATACCA 0: 1
1: 0
2: 2
3: 13
4: 119
Right 1022776405 7:33532054-33532076 CAAACAGCACCCACGTCACAGGG 0: 1
1: 0
2: 3
3: 18
4: 192
1022776402_1022776408 30 Left 1022776402 7:33532025-33532047 CCAGTCACTCTCAGGGAATACCA 0: 1
1: 0
2: 2
3: 13
4: 119
Right 1022776408 7:33532078-33532100 GACAAGAGCTATGATGCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022776402 Original CRISPR TGGTATTCCCTGAGAGTGAC TGG (reversed) Intronic
905239522 1:36572732-36572754 GGCTCTTCCCTGAGAGGGACAGG + Intergenic
906781963 1:48580605-48580627 TTTAATTTCCTGAGAGTGACTGG + Intronic
913529614 1:119724448-119724470 TGGTATTCACTGATATTCACTGG + Intronic
913966562 1:143381832-143381854 AGGTCTACACTGAGAGTGACGGG + Intergenic
914060937 1:144207439-144207461 AGGTCTACACTGAGAGTGACGGG + Intergenic
914118213 1:144758930-144758952 AGGTCTACACTGAGAGTGACGGG - Intergenic
916818295 1:168374116-168374138 AGCTGTTCCCTGAGAGTTACAGG + Intergenic
918088174 1:181263030-181263052 TGGTTTTCCCTGAGGCTGAGTGG + Intergenic
919838514 1:201592902-201592924 TGGTAGTATCTGAGAGTGATAGG - Intergenic
921875463 1:220190920-220190942 TGGTTTTTCCTGTGAGTGCCTGG - Intronic
1067154224 10:43762296-43762318 TGGTATTAGCTGGGAGTGAAAGG - Intergenic
1067921225 10:50459810-50459832 TGCTATTCCCAGAGAGTAAGTGG - Intronic
1068569234 10:58610275-58610297 TGTTGTGCCCTGAGTGTGACAGG + Intronic
1071887465 10:89966627-89966649 TGGTATACCCAGAGAGGGAAAGG + Intergenic
1075215163 10:120526399-120526421 TGGGCTTCACTGAGGGTGACTGG + Intronic
1076156992 10:128211929-128211951 TGGTATTGCCTGAGAGGGACGGG + Intergenic
1080928286 11:36781555-36781577 TGCTATTTCCTTAGTGTGACTGG + Intergenic
1083243352 11:61406321-61406343 AGCTGTTCCCTGAGAGTGAAAGG - Intronic
1085327426 11:75617788-75617810 TGGTAAACCCTGACAGTGACGGG - Intronic
1085348187 11:75781464-75781486 TGGGATTGCCTGAGAGGGCCTGG + Intronic
1085979401 11:81705357-81705379 GGGAATTCCCTGAGACTGAGGGG + Intergenic
1086306068 11:85482587-85482609 TGGTATTGCCTTAGAGGCACAGG - Intronic
1086865620 11:91976322-91976344 TTGCATTCCCAAAGAGTGACAGG - Intergenic
1088028366 11:105215204-105215226 TGATGCTCCCTGAGAGTGAATGG + Intergenic
1091854887 12:3731521-3731543 TGGTGCTGCCTGAAAGTGACTGG - Intronic
1095768575 12:45924803-45924825 TGGTAGTCCCTGAGATACACTGG + Exonic
1097420529 12:59373079-59373101 GGGTATTTCCAGAAAGTGACTGG + Intergenic
1097699991 12:62810065-62810087 TGGTATTCCCAATGAGTGTCTGG + Intronic
1098488570 12:71049528-71049550 GTGTATTCCCTTAGAGTGTCAGG + Intronic
1101413773 12:104491277-104491299 TGGAGTTTTCTGAGAGTGACCGG + Intronic
1103197566 12:119058397-119058419 AGATATTCCCTGAGACTGATGGG + Intronic
1104997624 12:132668478-132668500 TGGTATTCGCTGCGACTGGCTGG + Exonic
1105031666 12:132888179-132888201 GGGTATTCCCTGAAAGTGAAAGG + Intronic
1109935447 13:69277316-69277338 TGGTATCTCCTGTGAGTGTCTGG + Intergenic
1110192734 13:72750063-72750085 TGGTATTTACTGAGAGTAACGGG + Intronic
1111958209 13:94781111-94781133 TGGTCTTCCCTTAGGGTGATAGG + Intergenic
1124123043 15:26908697-26908719 CTGTATTGCCTGAGAGTCACGGG + Intronic
1125658817 15:41380079-41380101 TGCTCTTCCCTGAGAGGGATAGG - Exonic
1128744347 15:70103120-70103142 TGGGATTCCCAGAGAGGGAGAGG - Intergenic
1130702194 15:86195654-86195676 TGGTGAACACTGAGAGTGACAGG - Intronic
1139364321 16:66424468-66424490 TGGGATTCCCTGTGAGCGGCTGG + Intergenic
1141852521 16:86656873-86656895 TTGTTTTCCTTGAAAGTGACAGG + Intergenic
1149952302 17:61002665-61002687 TGGTATTCACTCAGAGGAACTGG - Intronic
1159939154 18:74392810-74392832 TGTTATTCCCTGAGTGTTCCTGG - Intergenic
1164544979 19:29152773-29152795 TGGGTTTTCCTGAGAGTGATGGG + Intergenic
1202700345 1_KI270712v1_random:159327-159349 AGGTCTACACTGAGAGTGACGGG + Intergenic
930135031 2:47894079-47894101 AAGTATCCCCTGAGAATGACAGG - Intronic
930386191 2:50698247-50698269 TGGTAGTCCCTGAGACTTTCGGG + Intronic
934171277 2:89542803-89542825 AGGTCTACACTGAGAGTGACGGG + Intergenic
934281583 2:91617121-91617143 AGGTCTACACTGAGAGTGACGGG + Intergenic
935325985 2:101937187-101937209 TGGTATACCCTGAAAGTGACAGG + Intergenic
935472655 2:103478853-103478875 TGTTTTTCCCTGAGAGTCCCAGG + Intergenic
937136633 2:119559158-119559180 GGGAATTCTCTGACAGTGACAGG - Intronic
937146474 2:119649687-119649709 TTTTATTCCCTGAGTGTCACAGG + Intronic
944426226 2:199586185-199586207 TTGTCTTCCCTGAGAGAGACTGG - Intergenic
944685441 2:202113397-202113419 GGGTATGCCCTGGGAGGGACAGG - Exonic
947080998 2:226396851-226396873 TAGAATTTCCTGAGGGTGACTGG - Intergenic
947966845 2:234289286-234289308 TGGTAATCCCTCAGAGTCACAGG - Intergenic
948687235 2:239676949-239676971 TTGTATTCCCTGTGTGTGAGTGG - Intergenic
948737698 2:240020172-240020194 TGGTTTTCACTGGGAGTGGCCGG - Intronic
1169053923 20:2604296-2604318 TGGTATTTCCTGAAATTAACTGG - Intronic
1170297995 20:14850378-14850400 TGATATTCCCTGAGAGAGAATGG - Intronic
1174419738 20:50391684-50391706 TGGCTTTCCCTGGGAGTGCCCGG - Intergenic
1175728668 20:61336882-61336904 TGCTTTCCCCTGAGAGAGACTGG - Intronic
1175782620 20:61693135-61693157 TGGTGTGCCTTGAAAGTGACTGG - Intronic
1178035871 21:28581625-28581647 TGATATTCCCTAGGAGAGACAGG + Intergenic
1181939036 22:26461418-26461440 TGGAATTCCCTCAGAGGGAGTGG - Intronic
1182369959 22:29803889-29803911 TGGAATACCCTGAGCCTGACTGG - Intronic
951091825 3:18582996-18583018 ATATATTCCCTGAGAGGGACAGG + Intergenic
951296517 3:20942780-20942802 TGGAAATTCCTGAGAGTTACAGG - Intergenic
952209647 3:31216701-31216723 TCCTTTTCCCTGAGAGTGAAAGG - Intergenic
960048957 3:113222762-113222784 TGGGATTTCCTGAGTGTGCCTGG + Intronic
961115729 3:124328226-124328248 TGGTAGTGACTGATAGTGACTGG + Intronic
962432726 3:135335024-135335046 TGGTGTCCTCTGAGAGTGAGTGG - Intergenic
963348221 3:144121919-144121941 TGTTATTCCATGAAAGTGGCAGG - Intergenic
963718730 3:148835172-148835194 TGGTATTCAGTGAGGGAGACAGG - Intronic
967932182 3:194698180-194698202 TGGGATACCCTGAGGGTGAAAGG - Intergenic
969028493 4:4193085-4193107 GGGTCTACACTGAGAGTGACGGG - Intronic
970653081 4:18199322-18199344 TGGTGATACCGGAGAGTGACTGG + Intergenic
971832958 4:31721504-31721526 TGCTATTCCTTGTGATTGACTGG + Intergenic
973976154 4:56264495-56264517 TGGTATTCCCTGAAAGGGGCTGG + Intronic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
976830907 4:89312846-89312868 TGATATTACCTGAGTGTGTCTGG + Intergenic
980171134 4:129291549-129291571 TTGTTGTACCTGAGAGTGACAGG - Intergenic
981644195 4:146979954-146979976 TGGTACTCCCTGAGAGTATTAGG - Intergenic
984760233 4:183357126-183357148 TGTTATTTCCTGAGAGTGGAGGG - Intergenic
985329842 4:188819343-188819365 TGGTTTTCTCTGAGAGTCAATGG - Intergenic
985805014 5:2037201-2037223 TGGTTTTCCCTGGCAGTGAAGGG + Intergenic
987550648 5:19375900-19375922 TGGTGTACTCTTAGAGTGACTGG + Intergenic
987561452 5:19527902-19527924 TATTATTACCTGAGAGTAACAGG + Intronic
994144827 5:96383343-96383365 TGCTATACCCTGAGACTGAGTGG + Intergenic
995295889 5:110521184-110521206 GGGTATTCCATGAGAGAGAAAGG - Intronic
998614144 5:143720859-143720881 TGGAAGTCACTGTGAGTGACAGG + Intergenic
1000993423 5:167934705-167934727 TGGTATGCCCTGAGTCAGACAGG - Intronic
1005208381 6:23431378-23431400 TTGTTGTCCCTGAAAGTGACGGG - Intergenic
1005682775 6:28223515-28223537 TGGTTAGCCCTGAGAGAGACTGG - Intergenic
1008994057 6:57637776-57637798 TGATTCTCCCTGAAAGTGACCGG + Intronic
1009411325 6:63368437-63368459 TGGGATTCCCAGAGAATGCCAGG + Intergenic
1012013247 6:93820345-93820367 TGATATTCACTGAAACTGACTGG + Intergenic
1012909739 6:105105271-105105293 AGGTAGTCCCTGGAAGTGACAGG - Intronic
1015507842 6:134007598-134007620 TTTTATTATCTGAGAGTGACAGG + Intronic
1018205926 6:161436860-161436882 TGGTATTCACTTAGGGAGACCGG + Intronic
1019914953 7:4127003-4127025 TGGTATTCTGTGATAGGGACAGG - Intronic
1022776402 7:33532025-33532047 TGGTATTCCCTGAGAGTGACTGG - Intronic
1023080404 7:36521244-36521266 TGGTATTGCCTGAGAGTAAATGG + Intronic
1025593982 7:62901366-62901388 TTGGATTACCTGAGAGTGACAGG + Intergenic
1027829324 7:83157117-83157139 TGACAGTCCCAGAGAGTGACTGG + Intronic
1027911077 7:84251717-84251739 TGTTTTATCCTGAGAGTGACTGG + Intronic
1028318499 7:89433993-89434015 TGGTATGGCCTGAGATTGAGGGG - Intergenic
1029206574 7:98872572-98872594 GGGTTCTCCCTGAGAGTTACAGG + Intergenic
1029306250 7:99622260-99622282 GGTTATTCCCAGAGTGTGACTGG + Intronic
1033212262 7:139468732-139468754 TGGGATTCCGTAAGTGTGACGGG + Intronic
1033677720 7:143560071-143560093 TGGTACAACCTGAGAGTGAATGG - Intergenic
1033694116 7:143769369-143769391 TGGTACAACCTGAGAGTGAATGG + Intergenic
1033857097 7:145577140-145577162 TGTTCTTCCCTGAGTGTCACAGG - Intergenic
1038425153 8:27460041-27460063 TGGTTTCCCCTGAGAGTGTCAGG + Exonic
1040311876 8:46241001-46241023 TGGTCTTCCACGAGAGAGACAGG - Intergenic
1040330733 8:46384509-46384531 GGGTATTCCATGAGAGACACAGG - Intergenic
1041967251 8:63693688-63693710 TGTTATTCTAGGAGAGTGACAGG + Intergenic
1043331596 8:79123640-79123662 TAATATTACCTGAGAATGACAGG + Intergenic
1044891618 8:96842144-96842166 TTTTATTCCCTGAGAATAACTGG - Intronic
1045264956 8:100611203-100611225 TGGTATTCCCTGAAGGTGAAGGG - Intronic
1046235308 8:111416511-111416533 TGGTTTTCCCTAAGAGAGAGAGG - Intergenic
1048433297 8:134390614-134390636 TGCTCTTCCCTGAGCGTGACAGG + Intergenic
1050728414 9:8678491-8678513 TGGAATGCCCTGAAAGTGAAGGG - Intronic
1052283649 9:26760450-26760472 TTGTATTCCCTGACAGTGCAGGG + Intergenic
1059307220 9:113363493-113363515 TCCTATTCCCTGACAGTGATGGG + Intronic
1062390148 9:136330592-136330614 TGGTTTTCCCTGGGGGTGTCTGG + Intronic
1185483593 X:466098-466120 TGGAGTTCTCTGAGATTGACAGG + Intergenic
1190998637 X:55636863-55636885 TGGCATTCCCTGAAAGTCCCTGG - Intergenic
1192169191 X:68843970-68843992 AGGTATTCCTTGAGAGCGAGGGG + Intergenic
1193481347 X:82032661-82032683 TCTGAATCCCTGAGAGTGACAGG - Intergenic
1194966060 X:100290002-100290024 AGGTATTCCCTGAGAGTTTCAGG - Intergenic
1196025693 X:111039511-111039533 TGGTCTTTAGTGAGAGTGACAGG - Intronic
1199954989 X:152735334-152735356 TGCTATTCCCTCAGAGAGCCTGG + Intronic