ID: 1022776914

View in Genome Browser
Species Human (GRCh38)
Location 7:33536260-33536282
Sequence CAGAGTGGCAAGCGGGTCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022776914_1022776924 29 Left 1022776914 7:33536260-33536282 CCGACGACCCGCTTGCCACTCTG 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1022776924 7:33536312-33536334 TTGATCTAATCAGAATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022776914 Original CRISPR CAGAGTGGCAAGCGGGTCGT CGG (reversed) Intronic
901059412 1:6465270-6465292 CAGGGTGGGAAGCAGGTCGGGGG - Intronic
903628060 1:24745381-24745403 CAGAGTGGCGCGGGGGGCGTGGG + Exonic
904199691 1:28811951-28811973 CAAAGTGGCAAGGGGGTGGGAGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
913518934 1:119627590-119627612 CAGAGGGGCTAGCGTGTCTTTGG - Intronic
915620668 1:157081476-157081498 CAGGGTGCCAAGCGGGTGTTGGG + Intergenic
1064564427 10:16625507-16625529 CAGAGTTGGAAACGTGTCGTGGG - Intronic
1066064396 10:31751575-31751597 CAGGGTGACAAGAGGGTCATTGG + Intergenic
1077026276 11:441444-441466 CAGAGTGGCCGGCGGGCTGTGGG - Intronic
1077608259 11:3626774-3626796 CAGAGTGCCCAGCGACTCGTGGG - Intergenic
1083188218 11:61030514-61030536 CAGAATGGGAAGCGGGTAGCAGG - Intergenic
1084346557 11:68554230-68554252 TAGAGTGGCAAGCAGGGGGTCGG - Exonic
1085788075 11:79472651-79472673 CACAGTGCCAAGCACGTCGTAGG - Intergenic
1087131494 11:94672802-94672824 CAGAGTGGCAAGGGGTGCGTGGG - Intergenic
1088598680 11:111457520-111457542 AAGGGTGGAAAGAGGGTCGTGGG - Intronic
1090805018 11:130197538-130197560 CAGAGAGGCCAGCTGGTCGCAGG - Intronic
1090978281 11:131694454-131694476 CAGAGTGGGAAGCAGGGCTTAGG + Intronic
1099413347 12:82358810-82358832 CAGAGTGGGAAGCAGGTGGGTGG + Exonic
1114669153 14:24399562-24399584 CAGTGTGGCAGGCAGGTAGTGGG + Intronic
1116103143 14:40466465-40466487 CAGCTTGGCAAACTGGTCGTTGG + Intergenic
1117077258 14:52117003-52117025 CAGAATGGCAAGTTGGTCTTAGG - Intergenic
1120757428 14:88257335-88257357 GAGACTGGGAAGGGGGTCGTGGG - Intronic
1121249800 14:92490898-92490920 CAGAGAGGCAAGAGGGGCCTGGG - Intronic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1126979517 15:54226629-54226651 CAGAGTGGCAAGGGGTGTGTTGG + Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1129993403 15:79984155-79984177 GACAGTGGCAAGCAGGTTGTGGG - Intergenic
1131053401 15:89362332-89362354 CTGGGAGGCAAGCGGGGCGTGGG + Intergenic
1133109249 16:3535983-3536005 CAGAGTGGCAAGCAGGCTGTGGG - Intronic
1139088391 16:63616489-63616511 CAGAGTGGCAAGGGGTGTGTGGG + Intergenic
1143131780 17:4682929-4682951 CATTGTGGCAGGCGGGTCCTGGG + Exonic
1144593593 17:16546119-16546141 CAGAGAGGCAAAGGGGTCCTTGG + Intergenic
1157534475 18:48448240-48448262 CAGATTGGCAAGGGGGAAGTCGG - Intergenic
1157550287 18:48576469-48576491 CAGAGTGGCAAGTGGGACCCAGG - Intronic
1161195522 19:2984131-2984153 GAGAGTGGCAGGCGGGCTGTCGG - Intronic
1162132760 19:8537026-8537048 CAGTGTGGCCACCAGGTCGTTGG + Exonic
928404469 2:31004159-31004181 CAGAGCGGCAAGCTGGTCACTGG + Intronic
929598408 2:43190410-43190432 CAGAGTGGAAAGCCTGTCCTGGG - Intergenic
933651773 2:84855639-84855661 GAGAGTGGAAAGGGGGACGTGGG - Intronic
939394415 2:141610465-141610487 GAGAGTGGCAAGGGGGCTGTAGG - Intronic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179960026 21:44762896-44762918 CAGTGAGGCCAGCGGCTCGTGGG - Intergenic
1183662033 22:39226804-39226826 CAGAGTGGCAAGGGGCAGGTAGG - Intronic
950521658 3:13501286-13501308 CAGAGTGGCAGGGGAGTTGTGGG - Intronic
958584355 3:96068311-96068333 CAGAGTGGCAAGGGGTGTGTGGG + Intergenic
973544006 4:51962056-51962078 CAGACTGGCAAGGTGGTGGTGGG + Intergenic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
990521843 5:56588606-56588628 CAGAGTGGCTTGGGGGTCGGGGG + Intronic
999433436 5:151543507-151543529 CAGAGTGGCAATCTGGCCATTGG + Exonic
1005279699 6:24260183-24260205 CAGAGTGGCAACTGAGTCTTGGG + Intronic
1010833342 6:80557008-80557030 CAATGTGGCAAGAGGGTGGTGGG - Intergenic
1013149890 6:107434605-107434627 CATAGTGGCAGGTGGGTGGTAGG + Intronic
1017031775 6:150230229-150230251 CAAAGTGTGAAGCGGGTGGTGGG - Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022776914 7:33536260-33536282 CAGAGTGGCAAGCGGGTCGTCGG - Intronic
1030639621 7:111989258-111989280 CAGAGTGGCAAGCACATAGTGGG - Intronic
1031836252 7:126685117-126685139 AAGAGTGGCAAGCGGGGCCGGGG - Intronic
1038018215 8:23532415-23532437 CAGAGTGGCAAGGGGCACTTGGG + Intronic
1042591265 8:70402079-70402101 CAGAGTTGCATGCGGGGCGGGGG - Intronic
1047486899 8:125339420-125339442 CACAGTGGTGAGCGGGTGGTTGG + Intronic
1054743751 9:68833891-68833913 CAGAGAGGCAAGTGGGTGGCTGG + Intronic
1061283086 9:129608604-129608626 CAGAATGGCAATCGGCCCGTGGG + Intergenic
1061499229 9:130992688-130992710 CAGAGTGGCAGGGGAGTCCTGGG + Intergenic
1061796462 9:133088352-133088374 GAGAGTGGCTAGCTGGTCCTTGG - Intergenic
1062053329 9:134458324-134458346 CAGAGTGGGAAGGGGGTCTGTGG - Intergenic
1188518780 X:31014877-31014899 CAGAGAGGAAAACGGGTCCTTGG - Intergenic
1192205939 X:69096236-69096258 CAGAGTGGCGAGAGGATTGTAGG + Intergenic
1198342818 X:135731875-135731897 CAGAGTGGCAAGAGTGCCCTGGG - Intergenic
1198345171 X:135751420-135751442 CAGAGTGGCAAGAGTGCCCTGGG + Intergenic
1199833175 X:151563660-151563682 CAGAGTGCAAAGCGCGTGGTGGG - Exonic