ID: 1022779636

View in Genome Browser
Species Human (GRCh38)
Location 7:33566990-33567012
Sequence GGGGTAATGAGACCAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1022779629_1022779636 13 Left 1022779629 7:33566954-33566976 CCCAGGTTGTAAGTTTCTTTCCA 0: 1
1: 0
2: 0
3: 26
4: 267
Right 1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 137
1022779630_1022779636 12 Left 1022779630 7:33566955-33566977 CCAGGTTGTAAGTTTCTTTCCAG 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 137
1022779635_1022779636 -7 Left 1022779635 7:33566974-33566996 CCAGTGGTAGTTCAGTGGGGTAA 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 137
1022779628_1022779636 14 Left 1022779628 7:33566953-33566975 CCCCAGGTTGTAAGTTTCTTTCC 0: 1
1: 0
2: 0
3: 17
4: 243
Right 1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1022779636 Original CRISPR GGGGTAATGAGACCAATAAA AGG Intronic
903870309 1:26429284-26429306 GGGGTCAGGAGGCCAAGAAAGGG + Exonic
905781689 1:40716390-40716412 GGGTTAAGGAGAGCAGTAAATGG + Intronic
907472724 1:54684890-54684912 GGCTGAATGAGAACAATAAATGG - Intronic
911766967 1:101689104-101689126 GGGATACTGAGACCTAGAAATGG - Intergenic
912739414 1:112179932-112179954 GGGGAAATGAGACAAGTAACAGG - Intergenic
913384353 1:118243062-118243084 GTGGTGAAGTGACCAATAAAAGG - Intergenic
915033675 1:152905221-152905243 AGGGAGATGAGACCAAGAAAGGG - Intergenic
915108500 1:153548701-153548723 GGGGCAATGAGACCTCTACATGG - Intronic
915601462 1:156925258-156925280 AGGGTAATGAGACTAATGCAGGG - Intronic
917620271 1:176788436-176788458 GGTGTAATGAGACTAGAAAATGG + Intronic
918137541 1:181687612-181687634 GGGGCATTGGGACAAATAAAAGG + Intronic
918891179 1:190271163-190271185 GAGATAATTAGACCAATAGAAGG + Intronic
919128198 1:193422275-193422297 GGGGGAATGAGACAAGTAAAAGG - Intergenic
919994036 1:202731124-202731146 GGGTTTATGAGACAAATAGAAGG + Intronic
921809755 1:219499155-219499177 GGGGAAATGAGAAAAAAAAAAGG + Intergenic
922989754 1:229896450-229896472 GGGTTGATGAGATGAATAAATGG + Intergenic
1063629551 10:7721172-7721194 GGGGAAATGAGACTCAAAAAGGG - Intronic
1064133547 10:12731017-12731039 GGGGAAATGAGATCAAGATAAGG + Intronic
1064422380 10:15201727-15201749 GAGATGATGAGACCCATAAATGG - Intergenic
1066433842 10:35378788-35378810 AGGGAAATGAGACCCAGAAATGG + Intronic
1069020049 10:63476288-63476310 AAGGTAATCAGAGCAATAAAAGG + Intergenic
1080142194 11:28935326-28935348 GATGTTATGAGACGAATAAAAGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081942409 11:46955229-46955251 GGGGTCAGGAGGCCAAGAAAGGG - Intronic
1085559133 11:77454188-77454210 GGGGTGTTGAGACAATTAAATGG - Intronic
1091025797 11:132140057-132140079 GGGTTAATGAGAAGATTAAATGG - Intronic
1094049407 12:26202762-26202784 GGGTTAATGATAACATTAAAAGG + Intronic
1095646871 12:44558175-44558197 GAGGAAATGGGACCAGTAAAAGG + Intronic
1096258458 12:50076718-50076740 GGGTTAAGGAAACCAATAAGGGG + Intronic
1098191084 12:67949079-67949101 GGACGAATGAGGCCAATAAAGGG + Intergenic
1099455888 12:82862378-82862400 GTGGTTATGAGGCTAATAAAGGG - Intronic
1099851211 12:88099634-88099656 AGGGTAATGAGACTAAAAAGAGG + Intronic
1100145561 12:91673390-91673412 TGGGTAATGTAACCCATAAAGGG + Intergenic
1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG + Intergenic
1106952078 13:34895464-34895486 CTGTTAATGAAACCAATAAAAGG - Intergenic
1107258821 13:38465737-38465759 GGTGTAAAGATACCAATAAAAGG - Intergenic
1107804428 13:44141215-44141237 GGGTTTATGAGATTAATAAATGG - Intergenic
1107990966 13:45818946-45818968 GGGGTATGGAGATGAATAAAAGG + Intronic
1109414043 13:62012018-62012040 GTGCTAATGAGACAAATACATGG - Intergenic
1111376200 13:87381426-87381448 GGGGTAAGGAGGCCAAGAAAGGG + Intergenic
1112013566 13:95312424-95312446 GAGGGAATGAAGCCAATAAAGGG - Intergenic
1115086471 14:29521446-29521468 AGTCTAATGAGACCAATAATAGG - Intergenic
1115267973 14:31521156-31521178 GAGGCAATGAGACCAGTCAAAGG - Intronic
1115858263 14:37655082-37655104 GGGGTAATGAGAGCTGTCAATGG - Intronic
1116143847 14:41037781-41037803 GGGGTATTGAGACCACGGAATGG + Intergenic
1116825076 14:49665308-49665330 GGGGTTATCAGACTAGTAAATGG - Intronic
1121614013 14:95300658-95300680 GTGGAAATGAGAAGAATAAATGG - Intronic
1122579043 14:102760202-102760224 GGAGTTATGAGACCAAGAAGGGG - Intergenic
1123948478 15:25250295-25250317 GGGGTCTTGAGTCCAAGAAAAGG + Intergenic
1124164475 15:27312060-27312082 AGGGTAAGGAGAACAATTAATGG + Intronic
1127429516 15:58888823-58888845 GGAGAAATGATACCATTAAATGG + Intronic
1127490771 15:59460693-59460715 TTTGAAATGAGACCAATAAAAGG + Intronic
1129540712 15:76345668-76345690 GTAGTAATGAGAGCAAGAAAGGG + Intergenic
1130655114 15:85786971-85786993 GAGGTCAGGAGACCAATAAGAGG + Intronic
1131770010 15:95727111-95727133 GGGTTTATGTGACTAATAAACGG + Intergenic
1131955023 15:97726185-97726207 GGGGCAATGAAACAAATAACAGG - Intergenic
1135858956 16:26037717-26037739 AGGGTAATGGCACCAATGAAAGG - Intronic
1140519516 16:75569206-75569228 GAGGAAATCAGACCAAAAAATGG - Intronic
1145989344 17:29069544-29069566 AGGGTAATAAGAGCAATAATTGG - Intergenic
1147369999 17:39985865-39985887 AGAATAATGAGACCAAAAAATGG - Intronic
1156245189 18:35290823-35290845 GGGTTAATGCTACCAAAAAAAGG - Intergenic
1156283052 18:35660192-35660214 GGGGTAAATATACTAATAAAAGG - Intronic
1156446838 18:37242869-37242891 GAGGTGATGGGAACAATAAAAGG - Intergenic
1165317226 19:35063897-35063919 GGGTTATTGAGACAATTAAAAGG + Intronic
1166371939 19:42306799-42306821 GAGGTGCTGAGACCAAGAAAGGG + Intronic
1167926738 19:52827316-52827338 CTGGAAAGGAGACCAATAAAGGG - Intronic
1168677086 19:58286360-58286382 AGTATAATGAGACCAACAAAGGG + Exonic
926831519 2:16967660-16967682 GGGGTAATAATACCAAGAACAGG + Intergenic
926873890 2:17453487-17453509 GGGGTAAAGAAACCAATTAAAGG + Intergenic
927991765 2:27453151-27453173 AGGGGAATTAGACCAATAAATGG - Intronic
928715749 2:34057984-34058006 GGCTTAATGAAACAAATAAAGGG - Intergenic
928769097 2:34684549-34684571 GGGTTAATGAACTCAATAAATGG + Intergenic
929620016 2:43345266-43345288 GGGGTAATGAGAAACAGAAAAGG + Intronic
929831452 2:45350102-45350124 GGTGGAATGAGGCCAATGAATGG - Intergenic
930406323 2:50960957-50960979 GTGGTAATGAGACCAATGTAAGG - Intronic
932636502 2:73393700-73393722 AGGGTACTAAGACCAATCAATGG - Intronic
941047957 2:160697590-160697612 AGGGTATTTAGACAAATAAATGG + Intergenic
942568399 2:177289212-177289234 GAGGAAATGAGATCTATAAATGG - Intronic
942737463 2:179131783-179131805 GGGGTAATCAGACAAATCACAGG - Intronic
946917644 2:224541896-224541918 GGGGTTAAGAGAACTATAAAGGG + Intronic
947824671 2:233097282-233097304 GGACTAATGAGAATAATAAATGG - Intronic
1170000017 20:11605383-11605405 GGGGTCAGGAGGCCAAGAAAGGG - Intergenic
1172348083 20:34220251-34220273 GGGGGAATCAGACTAATAAATGG + Intronic
1173225644 20:41161099-41161121 GGGGCAAGCAGACCAAGAAAAGG + Intronic
1174343893 20:49915485-49915507 GGGGTACTGAGACCAGTACCCGG + Intronic
1181733851 22:24866918-24866940 GGGGTTCTGAGACCAGAAAAAGG + Intronic
1182680759 22:32077732-32077754 AGGAAAATGAGACCAAGAAAAGG - Intronic
1183835012 22:40445109-40445131 GGGGTAATGAAATTAATATATGG - Intronic
1184421345 22:44384519-44384541 GGGGTCATGAGATCAAGAGAGGG + Intergenic
949237441 3:1826802-1826824 GAAGTAAGGAGACCAATAAATGG - Intergenic
951165388 3:19479580-19479602 GTGGTAATGGGAACAGTAAATGG - Intronic
952600447 3:35074582-35074604 GAGGTAATATCACCAATAAAAGG - Intergenic
952982758 3:38751500-38751522 ATTGTAAAGAGACCAATAAATGG - Intronic
955206263 3:56898651-56898673 GGGAAAATGAGACAAAGAAAAGG + Intronic
960547025 3:118927106-118927128 GGGGAAGAGAGAACAATAAAAGG + Intronic
960973622 3:123156162-123156184 GGGGTAATGAGAACTTTACAGGG + Intronic
962238677 3:133731647-133731669 ATGGTAATGACACCAATAGATGG - Intergenic
963131541 3:141862886-141862908 GAGGTGATGAAACCAATAAATGG + Intergenic
965196187 3:165598284-165598306 TGGGAAATGAAACCACTAAAAGG + Intergenic
967579921 3:191140297-191140319 GGAGTAATGAAACCGATGAAAGG - Intergenic
971585758 4:28403686-28403708 TGGGTAATGTGCTCAATAAAAGG + Intergenic
974523013 4:63009894-63009916 GGGGCAATGAAACCAGTAATTGG + Intergenic
974909765 4:68103070-68103092 GTGGTATTGGTACCAATAAATGG - Intronic
975434471 4:74335097-74335119 CGGGTAATGGGACCAGGAAATGG + Intergenic
977828516 4:101562311-101562333 GGGGAAATGAGAGTAATAGAAGG + Intronic
982799686 4:159688626-159688648 GGGGAAAGGAGAAAAATAAAGGG - Intergenic
984472583 4:180195046-180195068 GCGGTAATAAGACCAAGGAAAGG + Intergenic
986227138 5:5826435-5826457 GGAGGAATGAGACCAGAAAAGGG + Intergenic
987579182 5:19766481-19766503 GAGGTAATGAGACCACTTACAGG - Intronic
989746919 5:44839878-44839900 GGGAGAAATAGACCAATAAAAGG - Intergenic
990172150 5:53064321-53064343 AGGAAAATGAGACCAAGAAATGG + Intronic
993002157 5:82392026-82392048 GGGGCAATGAGAATATTAAATGG + Intergenic
995320785 5:110831344-110831366 GGGGCAATGAGACTAAAAAATGG - Intergenic
995475715 5:112546236-112546258 TGTATAATGTGACCAATAAAAGG - Intergenic
995943069 5:117608304-117608326 CTGGTAAAGAGACTAATAAAGGG - Intergenic
999480142 5:151940768-151940790 GGGGAAATGAGTTCAATAAAGGG + Intergenic
1000808362 5:165827027-165827049 GGGAAAAAGAGAACAATAAAGGG + Intergenic
1002409812 5:179064757-179064779 GGGGTAATGAGACCTGTGATTGG - Intronic
1005848566 6:29801535-29801557 GGGGTAAGGAGACGAATGAGGGG + Intergenic
1005868298 6:29954391-29954413 GGGGTAATGTGAGCAACCAAGGG - Intergenic
1007591964 6:43027274-43027296 TGGGTAATGAAAGCAATTAAAGG + Intronic
1009591095 6:65672155-65672177 GGGGAAAAGAGAAGAATAAAAGG + Intronic
1013174421 6:107665178-107665200 GGGGAAATAAGAACAGTAAAGGG - Intergenic
1013485396 6:110591497-110591519 GGGGTGCTGAGACCCATCAAAGG - Intergenic
1015502057 6:133944932-133944954 GGGGTAATGAGTCCAGTCAGGGG + Intergenic
1017549036 6:155484378-155484400 ATGGTAATGATACCAAGAAAAGG - Intergenic
1021436286 7:20619916-20619938 GGGGAAATGACTCCAAAAAATGG - Intronic
1022327344 7:29344219-29344241 GAGGCAGTGAGACCAATCAAGGG - Intronic
1022779636 7:33566990-33567012 GGGGTAATGAGACCAATAAAAGG + Intronic
1022818815 7:33938700-33938722 GAGGTGATGAGATCAAGAAAGGG - Intronic
1022858727 7:34342893-34342915 GGGGTAAGGAGACCCCTACAGGG - Intergenic
1026598683 7:71754986-71755008 GGGGTGATGAGTCCCACAAAGGG + Intergenic
1029067046 7:97860592-97860614 GGGATAATGAGATCAATCAAAGG - Intronic
1031024129 7:116662076-116662098 GGGGTCATCAGGCCCATAAAGGG + Intergenic
1032602332 7:133311082-133311104 GAGGAAATGAAACAAATAAATGG + Intronic
1033772221 7:144565102-144565124 GGGGTAGGGAGAGTAATAAACGG + Intronic
1034231770 7:149535141-149535163 GGGGAAATGAGAGCAGAAAAAGG + Intergenic
1040906646 8:52475917-52475939 GGGCTAATTAGACCAGTAGAGGG + Intergenic
1041584944 8:59505442-59505464 TGGGTAATGGGATCAATAGAAGG + Intergenic
1044163335 8:88948544-88948566 GGGGTCCTGAAACCAATAAAAGG + Intergenic
1048164078 8:132046580-132046602 GGGCTAATGGGACAAATATATGG + Intronic
1049219025 8:141420468-141420490 GGGGTCATGAGACCCAGAAAGGG + Intronic
1049666016 8:143843021-143843043 AGGGTAATGGGACCAATTACTGG - Intergenic
1051396501 9:16627647-16627669 GGTGTGAGGAGAACAATAAATGG - Intronic
1058343342 9:103925604-103925626 GGGGTAAAGAGGCCTACAAAGGG - Intergenic
1187627887 X:21137242-21137264 AGAATAATGAGAACAATAAAAGG + Intergenic
1187990989 X:24872097-24872119 GTTGTAATTAGACCAAAAAAAGG + Intronic
1188019807 X:25144757-25144779 GGGCTGATGAGACCAGTGAAGGG + Intergenic
1189550376 X:42086477-42086499 GAGGTAATGAGAAAAATACAAGG - Intergenic
1192948060 X:75986930-75986952 TGGGAAATGACACTAATAAAAGG + Intergenic
1196352280 X:114745841-114745863 AGGTTAATGAGAACAAAAAATGG + Intronic
1199433341 X:147785630-147785652 GGGGGAATGAGACCCAGAGAAGG + Intergenic